Incidental Mutation 'R8318:Ighv1-49'
ID641824
Institutional Source Beutler Lab
Gene Symbol Ighv1-49
Ensembl Gene ENSMUSG00000076710
Gene Nameimmunoglobulin heavy variable 1-49
SynonymsGm16830
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R8318 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location115055223-115055656 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 115055431 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 48 (F48S)
Ref Sequence ENSEMBL: ENSMUSP00000141739 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103519] [ENSMUST00000192724]
Predicted Effect probably damaging
Transcript: ENSMUST00000103519
AA Change: F29S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000100300
Gene: ENSMUSG00000076710
AA Change: F29S

DomainStartEndE-ValueType
IGv 17 98 5.3e-26 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000192724
AA Change: F48S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141739
Gene: ENSMUSG00000076710
AA Change: F48S

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGv 36 117 2.1e-28 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank1 T C 8: 23,115,551 V1145A probably damaging Het
Ankrd35 G A 3: 96,684,722 V775M probably damaging Het
Ankrd63 C T 2: 118,703,240 V67M unknown Het
Arhgef5 T A 6: 43,275,999 probably null Het
Atp13a2 A T 4: 141,007,024 Q1152H probably benign Het
Col7a1 G A 9: 108,958,374 A612T unknown Het
Csgalnact1 T C 8: 68,461,133 E140G probably damaging Het
Ddx18 G T 1: 121,566,087 A56D probably benign Het
Dixdc1 T C 9: 50,684,409 probably null Het
Dpys G A 15: 39,784,665 T498I probably benign Het
Ear6 A G 14: 51,854,265 I90V probably benign Het
Egr1 T C 18: 34,863,610 S482P probably damaging Het
Ehbp1 C T 11: 22,137,980 R393Q probably benign Het
Enpep A G 3: 129,270,337 I927T probably damaging Het
Ermard C T 17: 15,022,072 T406I possibly damaging Het
Etl4 T C 2: 20,788,530 S971P probably damaging Het
Fam63a A G 3: 95,292,625 S246G probably damaging Het
Fan1 C A 7: 64,350,055 V861F probably damaging Het
Fbp1 A G 13: 62,865,011 F328L probably benign Het
Fgd5 T A 6: 91,987,496 F237I probably benign Het
Fmn1 T C 2: 113,365,157 S401P unknown Het
Gabbr1 G A 17: 37,062,543 E444K probably benign Het
Htr3b C A 9: 48,964,877 probably benign Het
Kcnh4 A G 11: 100,752,328 L371P probably damaging Het
Kcnk15 A G 2: 163,858,269 T143A probably damaging Het
Klk1b4 T G 7: 44,210,911 S150A possibly damaging Het
Krt6a A T 15: 101,694,247 M1K probably null Het
Lama2 G A 10: 26,984,338 S3051L probably damaging Het
Lgals4 T C 7: 28,834,515 M38T probably benign Het
Lrrc16a A G 13: 24,036,459 L1094P probably benign Het
Mdn1 T C 4: 32,735,897 probably null Het
Myo18a A G 11: 77,823,389 T770A probably benign Het
Olfr1221 T A 2: 89,111,898 I205F probably benign Het
Olfr1254 C T 2: 89,788,977 C125Y possibly damaging Het
Olfr270 T C 4: 52,971,104 V161A probably benign Het
Pcdhb19 T A 18: 37,497,946 S265T possibly damaging Het
Pcna T C 2: 132,251,428 Y133C probably damaging Het
Polr2b A G 5: 77,335,729 E684G probably benign Het
Pon2 T C 6: 5,265,425 I321V probably benign Het
Prss54 T A 8: 95,564,466 M169L probably damaging Het
Rps3 T A 7: 99,483,731 probably benign Het
Senp1 T C 15: 98,064,867 D312G probably damaging Het
Serpina10 T A 12: 103,616,848 T446S possibly damaging Het
Slc2a5 A G 4: 150,139,658 D241G possibly damaging Het
Slc7a11 A G 3: 50,417,986 probably null Het
Tgfbrap1 G C 1: 43,056,669 C536W probably damaging Het
Trip11 C T 12: 101,912,804 G9S unknown Het
Zfp626 C A 7: 27,818,245 T217K possibly damaging Het
Other mutations in Ighv1-49
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Ighv1-49 APN 12 115055456 missense possibly damaging 0.89
R4473:Ighv1-49 UTSW 12 115055339 missense probably damaging 1.00
R4945:Ighv1-49 UTSW 12 115055408 missense possibly damaging 0.71
R5436:Ighv1-49 UTSW 12 115055461 missense probably damaging 1.00
R5662:Ighv1-49 UTSW 12 115055407 missense probably damaging 1.00
R8126:Ighv1-49 UTSW 12 115055610 critical splice donor site probably benign
Predicted Primers PCR Primer
(F):5'- CTGACACACTCAGGATGTGG -3'
(R):5'- GCTTGCCAGTTCCAAATCTG -3'

Sequencing Primer
(F):5'- GTGTCTTGCACAGTAATAGACCGC -3'
(R):5'- GCTTGCCAGTTCCAAATCTGAAGAAG -3'
Posted On2020-07-28