Mutagenetix > Incidental Mutation

Incidental Mutation 'R8319:Intu'

641842

Institutional Source

Beutler Lab

Gene Symbol

Intu

Ensembl Gene

ENSMUSG00000060798

Gene Name

inturned planar cell polarity protein

Synonyms

Pdzd6, Pdzk6, 9430087H23Rik, 9230116I04Rik

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8319 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

40531286-40704774 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 40653772 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Arginine at position 71 (S71R)

Ref Sequence

ENSEMBL: ENSMUSP00000088725 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061590] [ENSMUST00000091186]

AlphaFold

Q059U7

Predicted Effect

probably damaging
Transcript: ENSMUST00000061590
AA Change: S53R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000054313
Gene: ENSMUSG00000060798
AA Change: S53R

Domain	Start	End	E-Value	Type
low complexity region	46	63	N/A	INTRINSIC
Blast:PDZ	134	214	2e-25	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000091186
AA Change: S71R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000088725
Gene: ENSMUSG00000060798
AA Change: S71R

Domain	Start	End	E-Value	Type
low complexity region	21	48	N/A	INTRINSIC
low complexity region	64	81	N/A	INTRINSIC
PDZ	187	269	2.09e-3	SMART
low complexity region	459	468	N/A	INTRINSIC
low complexity region	774	784	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygous null mice show defective ciliogenesis and neural tube closure, abnormal patterning of the CNS and limbs, polydactyly, edema and death by E16.5. Homozygotes for a hypomorphic allele show defective ciliation and endochondral ossification, stunted growth, polydactyly and postnatal lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921517D22Rik	A	T	13: 59,690,672	D115E	probably benign	Het
Abcc1	T	A	16: 14,396,451	L197Q	probably damaging	Het
Adamts14	T	G	10: 61,221,927	N547T	probably benign	Het
Ampd3	T	A	7: 110,795,775	S301R	probably benign	Het
Atg9a	G	A	1: 75,185,698	Q523*	probably null	Het
Atl1	A	T	12: 69,955,319	T351S	probably damaging	Het
Bhlhe40	TG	TGG	6: 108,664,857	254	probably null	Het
Cacna1c	T	C	6: 118,637,774	I1315V		Het
Col12a1	C	T	9: 79,648,697	G2013R	probably damaging	Het
Cpne2	A	G	8: 94,553,412	D153G	probably benign	Het
Cryzl1	T	C	16: 91,692,363	S205G	probably benign	Het
Cux1	C	T	5: 136,565,397	A5T	probably benign	Het
Ddx60	T	C	8: 61,942,635		probably null	Het
Dnajc13	G	A	9: 104,190,391	P1190S	probably benign	Het
Fbxw7	T	A	3: 84,974,552	V526E		Het
Fig4	C	A	10: 41,263,101	G369C	probably damaging	Het
Gabra1	C	T	11: 42,135,488	A326T	probably damaging	Het
Gbe1	G	A	16: 70,488,076	G429S	probably benign	Het
Gm340	T	A	19: 41,582,904	S179T	probably damaging	Het
Gtf3c5	A	T	2: 28,570,494	H364Q	probably benign	Het
Hcfc2	T	A	10: 82,738,367	I125N	probably damaging	Het
Hnrnpul1	A	T	7: 25,754,477	D53E	probably benign	Het
Il18	A	T	9: 50,581,518	D128V	possibly damaging	Het
Klhl6	T	C	16: 19,957,190	E206G	possibly damaging	Het
Mcub	A	G	3: 129,933,679	F93L	probably damaging	Het
Mdga2	T	C	12: 67,221,029	Y5C	unknown	Het
Naip1	C	A	13: 100,429,213	V354L	probably benign	Het
Naip5	A	G	13: 100,221,659	V1023A	probably benign	Het
Ndufaf1	A	G	2: 119,660,087	L166P	probably damaging	Het
Ninl	A	T	2: 150,959,907	L147H	probably damaging	Het
Olfr1259	A	G	2: 89,943,680	V145A	possibly damaging	Het
Olfr64	A	G	7: 103,893,429	I102T	probably damaging	Het
Otogl	C	T	10: 107,853,266		probably null	Het
Otulin	AT	ATT	15: 27,606,318		probably null	Het
Phf11b	A	C	14: 59,338,697	L30R	probably damaging	Het
Prdm13	G	T	4: 21,679,327	H388N	unknown	Het
Pwwp2b	T	C	7: 139,255,183	V180A	probably damaging	Het
Reep4	T	A	14: 70,546,511	S23T	probably damaging	Het
Rusc2	T	A	4: 43,425,378	L1161Q	probably damaging	Het
Scgb1b3	G	A	7: 31,375,979		probably null	Het
Scn10a	G	T	9: 119,670,389	N279K	probably benign	Het
Smurf2	A	G	11: 106,824,752	L643S	probably damaging	Het
Sox12	G	A	2: 152,397,272	P143S	unknown	Het
Specc1	C	T	11: 62,118,675	T339I	possibly damaging	Het
Tas2r139	T	C	6: 42,141,786	V284A	probably benign	Het
Thumpd3	T	A	6: 113,063,146	C330*	probably null	Het
Ttc26	T	A	6: 38,405,945	H338Q	probably damaging	Het
Ttn	A	G	2: 76,706,954	S34877P	possibly damaging	Het
Zfp568	T	C	7: 29,998,204	S104P	possibly damaging	Het
Zfp933	G	A	4: 147,828,453	H50Y	possibly damaging	Het

Other mutations in Intu

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01292:Intu	APN	3	40664266	missense	probably benign	0.12
IGL01386:Intu	APN	3	40692587	missense	probably damaging	1.00
IGL02645:Intu	APN	3	40701272	missense	probably benign	0.01
IGL02869:Intu	APN	3	40687786	missense	probably damaging	1.00
IGL03263:Intu	APN	3	40672597	nonsense	probably null
H8562:Intu	UTSW	3	40692673	missense	probably damaging	1.00
PIT4495001:Intu	UTSW	3	40697603	missense	probably benign	0.07
R0010:Intu	UTSW	3	40654272	intron	probably benign
R0173:Intu	UTSW	3	40675346	critical splice donor site	probably null
R0426:Intu	UTSW	3	40675305	missense	probably damaging	0.97
R1566:Intu	UTSW	3	40692578	missense	probably damaging	0.99
R1619:Intu	UTSW	3	40697631	nonsense	probably null
R1658:Intu	UTSW	3	40692781	missense	probably benign	0.20
R1701:Intu	UTSW	3	40664264	missense	probably damaging	1.00
R1707:Intu	UTSW	3	40540924	missense	probably benign	0.03
R1707:Intu	UTSW	3	40683501	missense	possibly damaging	0.69
R1867:Intu	UTSW	3	40664335	missense	probably damaging	1.00
R1868:Intu	UTSW	3	40664335	missense	probably damaging	1.00
R2090:Intu	UTSW	3	40683536	missense	probably benign	0.00
R2310:Intu	UTSW	3	40653813	missense	probably benign
R2989:Intu	UTSW	3	40692710	missense	probably benign	0.11
R4168:Intu	UTSW	3	40672623	missense	probably benign	0.00
R4530:Intu	UTSW	3	40683364	missense	possibly damaging	0.95
R5093:Intu	UTSW	3	40692917	missense	probably benign	0.00
R5541:Intu	UTSW	3	40692587	splice site	probably null
R5587:Intu	UTSW	3	40675308	missense	probably damaging	0.99
R5745:Intu	UTSW	3	40692972	splice site	probably null
R5809:Intu	UTSW	3	40679590	missense	probably damaging	0.99
R5939:Intu	UTSW	3	40692584	missense	probably damaging	1.00
R5953:Intu	UTSW	3	40679550	missense	probably damaging	1.00
R6000:Intu	UTSW	3	40654148	nonsense	probably null
R6063:Intu	UTSW	3	40654094	missense	probably damaging	0.97
R6245:Intu	UTSW	3	40675326	missense	probably damaging	0.98
R6310:Intu	UTSW	3	40701291	nonsense	probably null
R6353:Intu	UTSW	3	40653708	missense	probably damaging	1.00
R6451:Intu	UTSW	3	40701293	missense	possibly damaging	0.94
R6660:Intu	UTSW	3	40531951	missense	probably benign	0.00
R6848:Intu	UTSW	3	40694255	missense	probably benign	0.00
R7440:Intu	UTSW	3	40697551	missense	probably benign	0.04
R7625:Intu	UTSW	3	40697599	missense	probably benign
R7633:Intu	UTSW	3	40654253	missense	probably damaging	1.00
R7798:Intu	UTSW	3	40691929	missense	probably damaging	1.00
R7877:Intu	UTSW	3	40699792	missense	probably benign	0.07
R7978:Intu	UTSW	3	40697639	missense	probably damaging	1.00
R8332:Intu	UTSW	3	40675289	missense	probably benign	0.35
R8860:Intu	UTSW	3	40672732	missense	probably benign	0.07
R8926:Intu	UTSW	3	40653709	missense	possibly damaging	0.69
R8946:Intu	UTSW	3	40683359	missense	possibly damaging	0.93
R9164:Intu	UTSW	3	40690703	missense	probably damaging	1.00
R9191:Intu	UTSW	3	40692511	missense	probably damaging	0.99
R9547:Intu	UTSW	3	40654106	missense	probably benign
Z1177:Intu	UTSW	3	40697516	missense	possibly damaging	0.80

Predicted Primers

PCR Primer
(F):5'- CATTTCTGCTGTCAAGGCTG -3'
(R):5'- TGATGTTTCAGAATGGACACGG -3'

Sequencing Primer
(F):5'- GCTGCCCCTCCTACACAG -3'
(R):5'- AATGGACACGGGCCCATTG -3'

Posted On

2020-07-28