Incidental Mutation 'R8319:Fbxw7'
ID641843
Institutional Source Beutler Lab
Gene Symbol Fbxw7
Ensembl Gene ENSMUSG00000028086
Gene NameF-box and WD-40 domain protein 7
SynonymsFbw7, 1110001A17Rik, AGO, Cdc4, Fbxw6, SEL-10, Fbxo30
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8319 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location84815268-84979198 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 84974552 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 526 (V526E)
Ref Sequence ENSEMBL: ENSMUSP00000103306 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029727] [ENSMUST00000107675] [ENSMUST00000107678] [ENSMUST00000107679] [ENSMUST00000154148]
Predicted Effect probably damaging
Transcript: ENSMUST00000029727
AA Change: V445E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029727
Gene: ENSMUSG00000028086
AA Change: V445E

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 139 146 N/A INTRINSIC
FBOX 206 246 3.7e-8 SMART
WD40 291 329 3.14e-6 SMART
WD40 332 369 2.1e-7 SMART
WD40 372 409 7.55e-9 SMART
WD40 412 449 2.22e-6 SMART
WD40 452 489 1.07e-8 SMART
WD40 492 529 1.75e-4 SMART
WD40 532 572 2.32e-9 SMART
WD40 575 623 2.37e2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000107675
AA Change: V405E

PolyPhen 2 Score 0.927 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000103302
Gene: ENSMUSG00000028086
AA Change: V405E

DomainStartEndE-ValueType
low complexity region 99 106 N/A INTRINSIC
FBOX 166 206 3.7e-8 SMART
WD40 251 289 3.14e-6 SMART
WD40 292 329 2.1e-7 SMART
WD40 332 369 7.55e-9 SMART
WD40 372 409 2.22e-6 SMART
WD40 412 449 1.07e-8 SMART
WD40 452 489 1.75e-4 SMART
WD40 492 532 2.32e-9 SMART
WD40 535 583 2.37e2 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000103305
Gene: ENSMUSG00000028086
AA Change: V526E

DomainStartEndE-ValueType
coiled coil region 94 129 N/A INTRINSIC
low complexity region 220 227 N/A INTRINSIC
FBOX 287 327 3.7e-8 SMART
WD40 372 410 3.14e-6 SMART
WD40 413 450 2.1e-7 SMART
WD40 453 490 7.55e-9 SMART
WD40 493 530 2.22e-6 SMART
WD40 533 570 1.07e-8 SMART
WD40 573 610 1.75e-4 SMART
WD40 613 653 2.32e-9 SMART
WD40 656 704 2.37e2 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000103306
Gene: ENSMUSG00000028086
AA Change: V526E

DomainStartEndE-ValueType
coiled coil region 94 129 N/A INTRINSIC
low complexity region 220 227 N/A INTRINSIC
FBOX 287 327 3.7e-8 SMART
WD40 372 410 3.14e-6 SMART
WD40 413 450 2.1e-7 SMART
WD40 453 490 7.55e-9 SMART
WD40 493 530 2.22e-6 SMART
WD40 533 570 1.07e-8 SMART
WD40 573 610 1.75e-4 SMART
WD40 613 653 2.32e-9 SMART
WD40 656 704 2.37e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154148
SMART Domains Protein: ENSMUSP00000116393
Gene: ENSMUSG00000102805

DomainStartEndE-ValueType
Arfaptin 1 227 7.15e-121 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene was previously referred to as FBX30, and belongs to the Fbws class; in addition to an F-box, this protein contains 7 tandem WD40 repeats. This protein binds directly to cyclin E and probably targets cyclin E for ubiquitin-mediated degradation. Mutations in this gene are detected in ovarian and breast cancer cell lines, implicating the gene's potential role in the pathogenesis of human cancers. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2012]
PHENOTYPE: Homozygous inactivation of this locus disrupts embryonic and extraembryonic vasculature, resulting in death by midgestation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik A T 13: 59,690,672 D115E probably benign Het
Abcc1 T A 16: 14,396,451 L197Q probably damaging Het
Adamts14 T G 10: 61,221,927 N547T probably benign Het
Ampd3 T A 7: 110,795,775 S301R probably benign Het
Atg9a G A 1: 75,185,698 Q523* probably null Het
Atl1 A T 12: 69,955,319 T351S probably damaging Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Cacna1c T C 6: 118,637,774 I1315V Het
Ccdc109b A G 3: 129,933,679 F93L probably damaging Het
Col12a1 C T 9: 79,648,697 G2013R probably damaging Het
Cpne2 A G 8: 94,553,412 D153G probably benign Het
Cryzl1 T C 16: 91,692,363 S205G probably benign Het
Cux1 C T 5: 136,565,397 A5T probably benign Het
Ddx60 T C 8: 61,942,635 probably null Het
Dnajc13 G A 9: 104,190,391 P1190S probably benign Het
Fig4 C A 10: 41,263,101 G369C probably damaging Het
Gabra1 C T 11: 42,135,488 A326T probably damaging Het
Gbe1 G A 16: 70,488,076 G429S probably benign Het
Gm340 T A 19: 41,582,904 S179T probably damaging Het
Gtf3c5 A T 2: 28,570,494 H364Q probably benign Het
Hcfc2 T A 10: 82,738,367 I125N probably damaging Het
Hnrnpul1 A T 7: 25,754,477 D53E probably benign Het
Il18 A T 9: 50,581,518 D128V possibly damaging Het
Intu T A 3: 40,653,772 S71R probably damaging Het
Klhl6 T C 16: 19,957,190 E206G possibly damaging Het
Mdga2 T C 12: 67,221,029 Y5C unknown Het
Naip1 C A 13: 100,429,213 V354L probably benign Het
Naip5 A G 13: 100,221,659 V1023A probably benign Het
Ndufaf1 A G 2: 119,660,087 L166P probably damaging Het
Ninl A T 2: 150,959,907 L147H probably damaging Het
Olfr1259 A G 2: 89,943,680 V145A possibly damaging Het
Olfr64 A G 7: 103,893,429 I102T probably damaging Het
Otogl C T 10: 107,853,266 probably null Het
Otulin AT ATT 15: 27,606,318 probably null Het
Phf11b A C 14: 59,338,697 L30R probably damaging Het
Prdm13 G T 4: 21,679,327 H388N unknown Het
Pwwp2b T C 7: 139,255,183 V180A probably damaging Het
Reep4 T A 14: 70,546,511 S23T probably damaging Het
Rusc2 T A 4: 43,425,378 L1161Q probably damaging Het
Scgb1b3 G A 7: 31,375,979 probably null Het
Scn10a G T 9: 119,670,389 N279K probably benign Het
Smurf2 A G 11: 106,824,752 L643S probably damaging Het
Sox12 G A 2: 152,397,272 P143S unknown Het
Specc1 C T 11: 62,118,675 T339I possibly damaging Het
Tas2r139 T C 6: 42,141,786 V284A probably benign Het
Thumpd3 T A 6: 113,063,146 C330* probably null Het
Ttc26 T A 6: 38,405,945 H338Q probably damaging Het
Ttn A G 2: 76,706,954 S34877P possibly damaging Het
Zfp568 T C 7: 29,998,204 S104P possibly damaging Het
Zfp933 G A 4: 147,828,453 H50Y possibly damaging Het
Other mutations in Fbxw7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00719:Fbxw7 APN 3 84969309 intron probably benign
IGL01468:Fbxw7 APN 3 84972499 missense probably benign 0.21
IGL01946:Fbxw7 APN 3 84904062 missense possibly damaging 0.60
IGL02248:Fbxw7 APN 3 84903633 missense possibly damaging 0.94
IGL02630:Fbxw7 APN 3 84965279 missense probably damaging 1.00
IGL02957:Fbxw7 APN 3 84976237 missense probably benign 0.00
PIT4453001:Fbxw7 UTSW 3 84965314 missense
R0043:Fbxw7 UTSW 3 84972567 intron probably benign
R0312:Fbxw7 UTSW 3 84967569 intron probably benign
R0595:Fbxw7 UTSW 3 84977367 splice site probably null
R1664:Fbxw7 UTSW 3 84969171 missense possibly damaging 0.45
R1709:Fbxw7 UTSW 3 84976352 missense probably damaging 1.00
R1782:Fbxw7 UTSW 3 84903819 missense probably benign
R1974:Fbxw7 UTSW 3 84954935 missense possibly damaging 0.53
R2081:Fbxw7 UTSW 3 84974513 missense probably damaging 1.00
R2843:Fbxw7 UTSW 3 84976220 missense probably damaging 1.00
R3732:Fbxw7 UTSW 3 84925707 missense possibly damaging 0.72
R3732:Fbxw7 UTSW 3 84925707 missense possibly damaging 0.72
R3733:Fbxw7 UTSW 3 84925707 missense possibly damaging 0.72
R4333:Fbxw7 UTSW 3 84972495 missense probably damaging 1.00
R4335:Fbxw7 UTSW 3 84972495 missense probably damaging 1.00
R4581:Fbxw7 UTSW 3 84967545 missense probably benign 0.41
R4776:Fbxw7 UTSW 3 84925689 missense possibly damaging 0.53
R4799:Fbxw7 UTSW 3 84903861 nonsense probably null
R4822:Fbxw7 UTSW 3 84967507 missense possibly damaging 0.94
R5512:Fbxw7 UTSW 3 84954909 missense probably damaging 0.99
R5601:Fbxw7 UTSW 3 84976208 missense probably damaging 1.00
R5679:Fbxw7 UTSW 3 84977487 missense probably damaging 1.00
R6026:Fbxw7 UTSW 3 84952641 critical splice donor site probably null
R6182:Fbxw7 UTSW 3 84815771 critical splice donor site probably null
R6219:Fbxw7 UTSW 3 84969213 missense probably damaging 0.99
R6305:Fbxw7 UTSW 3 84976323 missense probably damaging 1.00
R6473:Fbxw7 UTSW 3 84952380 intron probably benign
R6823:Fbxw7 UTSW 3 84958627 missense probably benign 0.33
R6922:Fbxw7 UTSW 3 84972416 splice site probably null
R7163:Fbxw7 UTSW 3 84925585 intron probably benign
R7229:Fbxw7 UTSW 3 84977369 missense unknown
R7554:Fbxw7 UTSW 3 84976313 missense
R7677:Fbxw7 UTSW 3 84904066 missense
R7711:Fbxw7 UTSW 3 84925681 missense probably benign
R7713:Fbxw7 UTSW 3 84967565 critical splice donor site probably null
R7873:Fbxw7 UTSW 3 84925764 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- AATGGTTTACCTGTCCTGTGC -3'
(R):5'- CAAAGGGGCAGCTTTTGGTC -3'

Sequencing Primer
(F):5'- GTGCATTCATTTCCTGACTCTTGTG -3'
(R):5'- GGGCAGCTTTTGGTCAAATTAATCC -3'
Posted On2020-07-28