Incidental Mutation 'R8319:Rusc2'
ID 641846
Institutional Source Beutler Lab
Gene Symbol Rusc2
Ensembl Gene ENSMUSG00000035969
Gene Name RUN and SH3 domain containing 2
Synonyms
MMRRC Submission 067856-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.207) question?
Stock # R8319 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 43381979-43427088 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 43425378 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 1161 (L1161Q)
Ref Sequence ENSEMBL: ENSMUSP00000038379 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035645] [ENSMUST00000052829] [ENSMUST00000098106] [ENSMUST00000107928] [ENSMUST00000107929] [ENSMUST00000131668] [ENSMUST00000149221] [ENSMUST00000149676] [ENSMUST00000171134] [ENSMUST00000173682]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000035645
AA Change: L1161Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000038379
Gene: ENSMUSG00000035969
AA Change: L1161Q

DomainStartEndE-ValueType
low complexity region 39 47 N/A INTRINSIC
low complexity region 212 230 N/A INTRINSIC
low complexity region 253 265 N/A INTRINSIC
low complexity region 411 427 N/A INTRINSIC
low complexity region 435 448 N/A INTRINSIC
low complexity region 530 544 N/A INTRINSIC
low complexity region 600 617 N/A INTRINSIC
low complexity region 795 809 N/A INTRINSIC
RUN 1109 1177 3.66e-21 SMART
low complexity region 1235 1260 N/A INTRINSIC
low complexity region 1289 1324 N/A INTRINSIC
low complexity region 1330 1341 N/A INTRINSIC
SH3 1457 1512 7.4e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000052829
SMART Domains Protein: ENSMUSP00000058980
Gene: ENSMUSG00000042788

DomainStartEndE-ValueType
Pfam:DUF2475 15 47 2.9e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000098106
AA Change: L1161Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000095710
Gene: ENSMUSG00000035969
AA Change: L1161Q

DomainStartEndE-ValueType
low complexity region 39 47 N/A INTRINSIC
low complexity region 212 230 N/A INTRINSIC
low complexity region 253 265 N/A INTRINSIC
low complexity region 411 427 N/A INTRINSIC
low complexity region 435 448 N/A INTRINSIC
low complexity region 530 544 N/A INTRINSIC
low complexity region 600 617 N/A INTRINSIC
low complexity region 795 809 N/A INTRINSIC
RUN 1109 1177 3.66e-21 SMART
low complexity region 1235 1260 N/A INTRINSIC
low complexity region 1289 1324 N/A INTRINSIC
low complexity region 1330 1341 N/A INTRINSIC
SH3 1457 1512 7.4e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107928
SMART Domains Protein: ENSMUSP00000103561
Gene: ENSMUSG00000042788

DomainStartEndE-ValueType
Pfam:DUF2475 15 76 1.3e-20 PFAM
Pfam:DUF2475 212 251 6.9e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107929
SMART Domains Protein: ENSMUSP00000103562
Gene: ENSMUSG00000042788

DomainStartEndE-ValueType
Pfam:DUF2475 15 76 1.5e-20 PFAM
Pfam:DUF2475 232 271 7.7e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000131668
AA Change: L1161Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118528
Gene: ENSMUSG00000035969
AA Change: L1161Q

DomainStartEndE-ValueType
low complexity region 39 47 N/A INTRINSIC
low complexity region 212 230 N/A INTRINSIC
low complexity region 253 265 N/A INTRINSIC
low complexity region 411 427 N/A INTRINSIC
low complexity region 435 448 N/A INTRINSIC
low complexity region 530 544 N/A INTRINSIC
low complexity region 600 617 N/A INTRINSIC
low complexity region 795 809 N/A INTRINSIC
RUN 1109 1177 3.66e-21 SMART
low complexity region 1235 1260 N/A INTRINSIC
low complexity region 1289 1324 N/A INTRINSIC
low complexity region 1330 1341 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000149221
Predicted Effect probably benign
Transcript: ENSMUST00000149676
Predicted Effect probably benign
Transcript: ENSMUST00000155080
Predicted Effect probably benign
Transcript: ENSMUST00000171134
SMART Domains Protein: ENSMUSP00000127145
Gene: ENSMUSG00000042788

DomainStartEndE-ValueType
Pfam:DUF2475 15 76 7.2e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173682
SMART Domains Protein: ENSMUSP00000133715
Gene: ENSMUSG00000035969

DomainStartEndE-ValueType
low complexity region 39 47 N/A INTRINSIC
low complexity region 212 230 N/A INTRINSIC
low complexity region 253 265 N/A INTRINSIC
low complexity region 411 427 N/A INTRINSIC
low complexity region 435 448 N/A INTRINSIC
low complexity region 530 544 N/A INTRINSIC
low complexity region 685 703 N/A INTRINSIC
low complexity region 733 740 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a RUN and SH3 domain containing protein that interacts with Rab1b and Rab1-binding protein GM130. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Jun 2012]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik A T 13: 59,838,486 (GRCm39) D115E probably benign Het
Abcc1 T A 16: 14,214,315 (GRCm39) L197Q probably damaging Het
Adamts14 T G 10: 61,057,706 (GRCm39) N547T probably benign Het
Ampd3 T A 7: 110,394,982 (GRCm39) S301R probably benign Het
Atg9a G A 1: 75,162,342 (GRCm39) Q523* probably null Het
Atl1 A T 12: 70,002,093 (GRCm39) T351S probably damaging Het
Bhlhe40 TG TGG 6: 108,641,818 (GRCm39) 254 probably null Het
Cacna1c T C 6: 118,614,735 (GRCm39) I1315V Het
Col12a1 C T 9: 79,555,979 (GRCm39) G2013R probably damaging Het
Cpne2 A G 8: 95,280,040 (GRCm39) D153G probably benign Het
Cryzl1 T C 16: 91,489,251 (GRCm39) S205G probably benign Het
Cux1 C T 5: 136,594,251 (GRCm39) A5T probably benign Het
Ddx60 T C 8: 62,395,669 (GRCm39) probably null Het
Dnajc13 G A 9: 104,067,590 (GRCm39) P1190S probably benign Het
Fbxw7 T A 3: 84,881,859 (GRCm39) V526E Het
Fig4 C A 10: 41,139,097 (GRCm39) G369C probably damaging Het
Gabra1 C T 11: 42,026,315 (GRCm39) A326T probably damaging Het
Gbe1 G A 16: 70,284,964 (GRCm39) G429S probably benign Het
Gtf3c5 A T 2: 28,460,506 (GRCm39) H364Q probably benign Het
Hcfc2 T A 10: 82,574,201 (GRCm39) I125N probably damaging Het
Hnrnpul1 A T 7: 25,453,902 (GRCm39) D53E probably benign Het
Ift56 T A 6: 38,382,880 (GRCm39) H338Q probably damaging Het
Il18 A T 9: 50,492,818 (GRCm39) D128V possibly damaging Het
Intu T A 3: 40,608,202 (GRCm39) S71R probably damaging Het
Klhl6 T C 16: 19,775,940 (GRCm39) E206G possibly damaging Het
Lcor T A 19: 41,571,343 (GRCm39) S179T probably damaging Het
Mcub A G 3: 129,727,328 (GRCm39) F93L probably damaging Het
Mdga2 T C 12: 67,267,803 (GRCm39) Y5C unknown Het
Naip1 C A 13: 100,565,721 (GRCm39) V354L probably benign Het
Naip5 A G 13: 100,358,167 (GRCm39) V1023A probably benign Het
Ndufaf1 A G 2: 119,490,568 (GRCm39) L166P probably damaging Het
Ninl A T 2: 150,801,827 (GRCm39) L147H probably damaging Het
Or4c12 A G 2: 89,774,024 (GRCm39) V145A possibly damaging Het
Or51b17 A G 7: 103,542,636 (GRCm39) I102T probably damaging Het
Otogl C T 10: 107,689,127 (GRCm39) probably null Het
Otulin AT ATT 15: 27,606,404 (GRCm39) probably null Het
Phf11b A C 14: 59,576,146 (GRCm39) L30R probably damaging Het
Prdm13 G T 4: 21,679,327 (GRCm39) H388N unknown Het
Pwwp2b T C 7: 138,835,099 (GRCm39) V180A probably damaging Het
Reep4 T A 14: 70,783,951 (GRCm39) S23T probably damaging Het
Scgb1b3 G A 7: 31,075,404 (GRCm39) probably null Het
Scn10a G T 9: 119,499,455 (GRCm39) N279K probably benign Het
Smurf2 A G 11: 106,715,578 (GRCm39) L643S probably damaging Het
Sox12 G A 2: 152,239,192 (GRCm39) P143S unknown Het
Specc1 C T 11: 62,009,501 (GRCm39) T339I possibly damaging Het
Tas2r139 T C 6: 42,118,720 (GRCm39) V284A probably benign Het
Thumpd3 T A 6: 113,040,107 (GRCm39) C330* probably null Het
Ttn A G 2: 76,537,298 (GRCm39) S34877P possibly damaging Het
Zfp568 T C 7: 29,697,629 (GRCm39) S104P possibly damaging Het
Zfp933 G A 4: 147,912,910 (GRCm39) H50Y possibly damaging Het
Other mutations in Rusc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01358:Rusc2 APN 4 43,426,116 (GRCm39) missense probably damaging 0.97
IGL01474:Rusc2 APN 4 43,416,434 (GRCm39) missense probably damaging 0.98
IGL01541:Rusc2 APN 4 43,415,840 (GRCm39) missense probably benign 0.08
IGL01628:Rusc2 APN 4 43,425,729 (GRCm39) missense probably damaging 1.00
IGL01969:Rusc2 APN 4 43,415,738 (GRCm39) missense probably benign 0.02
IGL02030:Rusc2 APN 4 43,416,095 (GRCm39) missense possibly damaging 0.86
IGL02079:Rusc2 APN 4 43,425,668 (GRCm39) missense probably benign
IGL02115:Rusc2 APN 4 43,426,136 (GRCm39) splice site probably benign
IGL02122:Rusc2 APN 4 43,421,685 (GRCm39) missense possibly damaging 0.67
IGL02350:Rusc2 APN 4 43,425,351 (GRCm39) missense possibly damaging 0.86
IGL02357:Rusc2 APN 4 43,425,351 (GRCm39) missense possibly damaging 0.86
IGL02437:Rusc2 APN 4 43,415,545 (GRCm39) missense probably damaging 1.00
IGL02930:Rusc2 APN 4 43,416,376 (GRCm39) missense probably damaging 0.99
IGL03154:Rusc2 APN 4 43,425,806 (GRCm39) missense probably benign 0.00
P0026:Rusc2 UTSW 4 43,415,840 (GRCm39) missense possibly damaging 0.93
R0036:Rusc2 UTSW 4 43,424,009 (GRCm39) missense probably damaging 1.00
R0068:Rusc2 UTSW 4 43,424,100 (GRCm39) splice site probably benign
R0068:Rusc2 UTSW 4 43,424,100 (GRCm39) splice site probably benign
R0114:Rusc2 UTSW 4 43,422,055 (GRCm39) missense probably damaging 1.00
R0255:Rusc2 UTSW 4 43,423,954 (GRCm39) missense probably damaging 1.00
R0471:Rusc2 UTSW 4 43,425,486 (GRCm39) missense probably damaging 0.99
R1381:Rusc2 UTSW 4 43,416,137 (GRCm39) missense probably damaging 1.00
R1413:Rusc2 UTSW 4 43,416,568 (GRCm39) missense probably benign 0.00
R1416:Rusc2 UTSW 4 43,421,617 (GRCm39) missense possibly damaging 0.86
R1731:Rusc2 UTSW 4 43,426,046 (GRCm39) missense probably benign
R1864:Rusc2 UTSW 4 43,421,719 (GRCm39) missense possibly damaging 0.49
R1897:Rusc2 UTSW 4 43,421,749 (GRCm39) missense probably damaging 1.00
R2010:Rusc2 UTSW 4 43,415,212 (GRCm39) missense probably benign 0.06
R2212:Rusc2 UTSW 4 43,415,935 (GRCm39) missense probably damaging 1.00
R2275:Rusc2 UTSW 4 43,416,260 (GRCm39) missense probably damaging 1.00
R2885:Rusc2 UTSW 4 43,415,456 (GRCm39) missense probably benign 0.28
R2886:Rusc2 UTSW 4 43,415,456 (GRCm39) missense probably benign 0.28
R3412:Rusc2 UTSW 4 43,415,935 (GRCm39) missense probably damaging 1.00
R3413:Rusc2 UTSW 4 43,415,935 (GRCm39) missense probably damaging 1.00
R3414:Rusc2 UTSW 4 43,415,935 (GRCm39) missense probably damaging 1.00
R3852:Rusc2 UTSW 4 43,416,424 (GRCm39) missense probably benign 0.45
R4135:Rusc2 UTSW 4 43,425,563 (GRCm39) missense possibly damaging 0.49
R4272:Rusc2 UTSW 4 43,415,533 (GRCm39) missense probably damaging 1.00
R4574:Rusc2 UTSW 4 43,416,080 (GRCm39) missense probably damaging 0.99
R4888:Rusc2 UTSW 4 43,423,942 (GRCm39) missense probably damaging 1.00
R5010:Rusc2 UTSW 4 43,415,926 (GRCm39) missense probably damaging 1.00
R5071:Rusc2 UTSW 4 43,415,240 (GRCm39) missense probably benign 0.05
R5131:Rusc2 UTSW 4 43,414,948 (GRCm39) missense probably benign 0.03
R5177:Rusc2 UTSW 4 43,421,805 (GRCm39) splice site probably null
R5540:Rusc2 UTSW 4 43,423,975 (GRCm39) missense probably damaging 1.00
R5561:Rusc2 UTSW 4 43,415,932 (GRCm39) nonsense probably null
R5628:Rusc2 UTSW 4 43,425,348 (GRCm39) missense probably damaging 1.00
R5645:Rusc2 UTSW 4 43,425,758 (GRCm39) missense probably benign 0.06
R6129:Rusc2 UTSW 4 43,424,271 (GRCm39) missense probably damaging 1.00
R6362:Rusc2 UTSW 4 43,416,416 (GRCm39) missense probably benign 0.30
R6633:Rusc2 UTSW 4 43,414,852 (GRCm39) missense probably damaging 0.99
R6980:Rusc2 UTSW 4 43,422,846 (GRCm39) missense probably benign 0.35
R7491:Rusc2 UTSW 4 43,426,528 (GRCm39) missense probably damaging 1.00
R7641:Rusc2 UTSW 4 43,425,335 (GRCm39) missense possibly damaging 0.84
R7698:Rusc2 UTSW 4 43,414,900 (GRCm39) nonsense probably null
R7710:Rusc2 UTSW 4 43,416,119 (GRCm39) missense probably benign 0.07
R8052:Rusc2 UTSW 4 43,421,851 (GRCm39) missense probably benign
R8061:Rusc2 UTSW 4 43,422,492 (GRCm39) missense probably damaging 1.00
R8127:Rusc2 UTSW 4 43,423,747 (GRCm39) missense possibly damaging 0.54
R8355:Rusc2 UTSW 4 43,422,846 (GRCm39) missense probably benign 0.35
R8397:Rusc2 UTSW 4 43,424,206 (GRCm39) missense possibly damaging 0.95
R8455:Rusc2 UTSW 4 43,422,846 (GRCm39) missense probably benign 0.35
R8553:Rusc2 UTSW 4 43,416,508 (GRCm39) missense probably benign 0.05
R8725:Rusc2 UTSW 4 43,401,351 (GRCm39) intron probably benign
R8725:Rusc2 UTSW 4 43,415,396 (GRCm39) missense probably damaging 0.99
R8727:Rusc2 UTSW 4 43,401,351 (GRCm39) intron probably benign
R8834:Rusc2 UTSW 4 43,416,431 (GRCm39) missense possibly damaging 0.94
R9295:Rusc2 UTSW 4 43,416,382 (GRCm39) missense probably damaging 0.98
R9483:Rusc2 UTSW 4 43,415,897 (GRCm39) missense probably damaging 0.97
R9666:Rusc2 UTSW 4 43,416,262 (GRCm39) missense probably benign 0.21
R9705:Rusc2 UTSW 4 43,424,936 (GRCm39) missense probably benign 0.00
X0025:Rusc2 UTSW 4 43,422,226 (GRCm39) missense probably benign 0.00
X0066:Rusc2 UTSW 4 43,422,204 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- GAAAGCAATGTCCACAGCTTG -3'
(R):5'- ACTTGCCATGATCCGAGCTC -3'

Sequencing Primer
(F):5'- CACAGCTTGTGGGGATGC -3'
(R):5'- TGTCCATGTCTCCAGGGC -3'
Posted On 2020-07-28