Incidental Mutation 'R8319:Ttc26'
ID641849
Institutional Source Beutler Lab
Gene Symbol Ttc26
Ensembl Gene ENSMUSG00000056832
Gene Nametetratricopeptide repeat domain 26
Synonyms
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.711) question?
Stock #R8319 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location38381469-38427647 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 38405945 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 338 (H338Q)
Ref Sequence ENSEMBL: ENSMUSP00000124369 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159145] [ENSMUST00000162554]
Predicted Effect probably benign
Transcript: ENSMUST00000159145
SMART Domains Protein: ENSMUSP00000124873
Gene: ENSMUSG00000056832

DomainStartEndE-ValueType
low complexity region 19 29 N/A INTRINSIC
Pfam:TPR_2 58 88 1.2e-5 PFAM
Pfam:TPR_8 58 91 1.7e-3 PFAM
Pfam:TPR_1 61 87 4.6e-4 PFAM
Pfam:TPR_11 63 113 4.9e-11 PFAM
Pfam:TPR_19 67 113 3.1e-7 PFAM
Pfam:TPR_8 89 113 2e-3 PFAM
Pfam:TPR_1 91 113 1.7e-4 PFAM
Pfam:TPR_2 91 113 2.4e-3 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000162554
AA Change: H338Q

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000124369
Gene: ENSMUSG00000056832
AA Change: H338Q

DomainStartEndE-ValueType
low complexity region 19 29 N/A INTRINSIC
Pfam:TPR_2 58 88 2.7e-5 PFAM
Pfam:TPR_11 63 117 9e-9 PFAM
Pfam:TPR_9 157 227 9.2e-4 PFAM
Blast:TPR 359 392 9e-10 BLAST
Blast:TPR 461 494 8e-15 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a spontaneous nonsense mutation exhibit partial prenatal lethality, a hopping gait, preaxial polydactyly, male sterility due to lack of sperm flagella, impaired hearing, and patterning defects that are typical of impaired Hedgehog signaling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik A T 13: 59,690,672 D115E probably benign Het
Abcc1 T A 16: 14,396,451 L197Q probably damaging Het
Adamts14 T G 10: 61,221,927 N547T probably benign Het
Ampd3 T A 7: 110,795,775 S301R probably benign Het
Atg9a G A 1: 75,185,698 Q523* probably null Het
Atl1 A T 12: 69,955,319 T351S probably damaging Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Cacna1c T C 6: 118,637,774 I1315V Het
Ccdc109b A G 3: 129,933,679 F93L probably damaging Het
Col12a1 C T 9: 79,648,697 G2013R probably damaging Het
Cpne2 A G 8: 94,553,412 D153G probably benign Het
Cryzl1 T C 16: 91,692,363 S205G probably benign Het
Cux1 C T 5: 136,565,397 A5T probably benign Het
Ddx60 T C 8: 61,942,635 probably null Het
Dnajc13 G A 9: 104,190,391 P1190S probably benign Het
Fbxw7 T A 3: 84,974,552 V526E Het
Fig4 C A 10: 41,263,101 G369C probably damaging Het
Gabra1 C T 11: 42,135,488 A326T probably damaging Het
Gbe1 G A 16: 70,488,076 G429S probably benign Het
Gm340 T A 19: 41,582,904 S179T probably damaging Het
Gtf3c5 A T 2: 28,570,494 H364Q probably benign Het
Hcfc2 T A 10: 82,738,367 I125N probably damaging Het
Hnrnpul1 A T 7: 25,754,477 D53E probably benign Het
Il18 A T 9: 50,581,518 D128V possibly damaging Het
Intu T A 3: 40,653,772 S71R probably damaging Het
Klhl6 T C 16: 19,957,190 E206G possibly damaging Het
Mdga2 T C 12: 67,221,029 Y5C unknown Het
Naip1 C A 13: 100,429,213 V354L probably benign Het
Naip5 A G 13: 100,221,659 V1023A probably benign Het
Ndufaf1 A G 2: 119,660,087 L166P probably damaging Het
Ninl A T 2: 150,959,907 L147H probably damaging Het
Olfr1259 A G 2: 89,943,680 V145A possibly damaging Het
Olfr64 A G 7: 103,893,429 I102T probably damaging Het
Otogl C T 10: 107,853,266 probably null Het
Otulin AT ATT 15: 27,606,318 probably null Het
Phf11b A C 14: 59,338,697 L30R probably damaging Het
Prdm13 G T 4: 21,679,327 H388N unknown Het
Pwwp2b T C 7: 139,255,183 V180A probably damaging Het
Reep4 T A 14: 70,546,511 S23T probably damaging Het
Rusc2 T A 4: 43,425,378 L1161Q probably damaging Het
Scgb1b3 G A 7: 31,375,979 probably null Het
Scn10a G T 9: 119,670,389 N279K probably benign Het
Smurf2 A G 11: 106,824,752 L643S probably damaging Het
Sox12 G A 2: 152,397,272 P143S unknown Het
Specc1 C T 11: 62,118,675 T339I possibly damaging Het
Tas2r139 T C 6: 42,141,786 V284A probably benign Het
Thumpd3 T A 6: 113,063,146 C330* probably null Het
Ttn A G 2: 76,706,954 S34877P possibly damaging Het
Zfp568 T C 7: 29,998,204 S104P possibly damaging Het
Zfp933 G A 4: 147,828,453 H50Y possibly damaging Het
Other mutations in Ttc26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00927:Ttc26 APN 6 38382220 splice site probably benign
IGL02049:Ttc26 APN 6 38425132 missense probably benign 0.16
IGL02403:Ttc26 APN 6 38409438 missense possibly damaging 0.95
IGL02902:Ttc26 APN 6 38425162 missense probably benign 0.21
IGL03189:Ttc26 APN 6 38425231 missense probably benign 0.00
IGL03410:Ttc26 APN 6 38385500 missense probably damaging 1.00
R0346:Ttc26 UTSW 6 38409435 missense probably damaging 1.00
R0562:Ttc26 UTSW 6 38401129 missense probably damaging 1.00
R0826:Ttc26 UTSW 6 38425114 splice site probably null
R1212:Ttc26 UTSW 6 38410793 missense probably damaging 1.00
R1778:Ttc26 UTSW 6 38409476 missense possibly damaging 0.93
R1972:Ttc26 UTSW 6 38410803 missense probably benign 0.20
R2903:Ttc26 UTSW 6 38401102 missense possibly damaging 0.61
R2904:Ttc26 UTSW 6 38401102 missense possibly damaging 0.61
R2905:Ttc26 UTSW 6 38401102 missense possibly damaging 0.61
R3788:Ttc26 UTSW 6 38403524 critical splice donor site probably null
R4222:Ttc26 UTSW 6 38395075 missense probably damaging 1.00
R4392:Ttc26 UTSW 6 38381557 start gained probably benign
R4930:Ttc26 UTSW 6 38391540 missense probably damaging 1.00
R5484:Ttc26 UTSW 6 38389122 missense probably benign 0.10
R5920:Ttc26 UTSW 6 38412070 missense probably damaging 1.00
R6229:Ttc26 UTSW 6 38395040 missense probably benign 0.22
R6429:Ttc26 UTSW 6 38398313 missense possibly damaging 0.69
R6901:Ttc26 UTSW 6 38401144 missense possibly damaging 0.80
R7448:Ttc26 UTSW 6 38404487 nonsense probably null
R7554:Ttc26 UTSW 6 38385500 missense probably null 1.00
R7650:Ttc26 UTSW 6 38395040 missense probably benign 0.22
X0066:Ttc26 UTSW 6 38405942 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AACTGATTCTACCTGTGTTCACAC -3'
(R):5'- TCTTTCACTGGTATGTTCAAAAGGG -3'

Sequencing Primer
(F):5'- GTGCTAATAAGAACTTGAGCA -3'
(R):5'- GTGACCCAGGATATCCTTCACAGTG -3'
Posted On2020-07-28