Incidental Mutation 'R8319:Bhlhe40'
ID641851
Institutional Source Beutler Lab
Gene Symbol Bhlhe40
Ensembl Gene ENSMUSG00000030103
Gene Namebasic helix-loop-helix family, member e40
SynonymsStra13, C130042M06Rik, eip1 (E47 interaction protein 1), Sharp2, Stra14, DEC1, Bhlhb2, cytokine response gene 8, CR8, Clast5
Accession Numbers

Genbank: NM_011498; MGI: 1097714

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8319 (G1)
Quality Score217.468
Status Not validated
Chromosome6
Chromosomal Location108660629-108666925 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) TG to TGG at 108664857 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000032194 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032194] [ENSMUST00000163617]
Predicted Effect probably null
Transcript: ENSMUST00000032194
SMART Domains Protein: ENSMUSP00000032194
Gene: ENSMUSG00000030103

DomainStartEndE-ValueType
HLH 58 113 2.52e-11 SMART
ORANGE 140 184 5.91e-13 SMART
low complexity region 230 248 N/A INTRINSIC
low complexity region 372 399 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137478
Predicted Effect probably benign
Transcript: ENSMUST00000163617
SMART Domains Protein: ENSMUSP00000132157
Gene: ENSMUSG00000030103

DomainStartEndE-ValueType
HLH 58 113 2.52e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166346
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204550
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a basic helix-loop-helix protein expressed in various tissues. The encoded protein can interact with Arntl or compete for E-box binding sites in the promoter of Per1 and repress Clock/Arntl's transactivation of Per1. This gene is believed to be involved in the control of circadian rhythm and cell differentiation. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygous mutation of this gene results in impaired immune function and hyperplasia of the lymphoid organs. Aging mutant animals exhibit autoimmune disease. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(2) Targeted, other(2)

Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik A T 13: 59,690,672 D115E probably benign Het
Abcc1 T A 16: 14,396,451 L197Q probably damaging Het
Adamts14 T G 10: 61,221,927 N547T probably benign Het
Ampd3 T A 7: 110,795,775 S301R probably benign Het
Atg9a G A 1: 75,185,698 Q523* probably null Het
Atl1 A T 12: 69,955,319 T351S probably damaging Het
Cacna1c T C 6: 118,637,774 I1315V Het
Ccdc109b A G 3: 129,933,679 F93L probably damaging Het
Col12a1 C T 9: 79,648,697 G2013R probably damaging Het
Cpne2 A G 8: 94,553,412 D153G probably benign Het
Cryzl1 T C 16: 91,692,363 S205G probably benign Het
Cux1 C T 5: 136,565,397 A5T probably benign Het
Ddx60 T C 8: 61,942,635 probably null Het
Dnajc13 G A 9: 104,190,391 P1190S probably benign Het
Fbxw7 T A 3: 84,974,552 V526E Het
Fig4 C A 10: 41,263,101 G369C probably damaging Het
Gabra1 C T 11: 42,135,488 A326T probably damaging Het
Gbe1 G A 16: 70,488,076 G429S probably benign Het
Gm340 T A 19: 41,582,904 S179T probably damaging Het
Gtf3c5 A T 2: 28,570,494 H364Q probably benign Het
Hcfc2 T A 10: 82,738,367 I125N probably damaging Het
Hnrnpul1 A T 7: 25,754,477 D53E probably benign Het
Il18 A T 9: 50,581,518 D128V possibly damaging Het
Intu T A 3: 40,653,772 S71R probably damaging Het
Klhl6 T C 16: 19,957,190 E206G possibly damaging Het
Mdga2 T C 12: 67,221,029 Y5C unknown Het
Naip1 C A 13: 100,429,213 V354L probably benign Het
Naip5 A G 13: 100,221,659 V1023A probably benign Het
Ndufaf1 A G 2: 119,660,087 L166P probably damaging Het
Ninl A T 2: 150,959,907 L147H probably damaging Het
Olfr1259 A G 2: 89,943,680 V145A possibly damaging Het
Olfr64 A G 7: 103,893,429 I102T probably damaging Het
Otogl C T 10: 107,853,266 probably null Het
Otulin AT ATT 15: 27,606,318 probably null Het
Phf11b A C 14: 59,338,697 L30R probably damaging Het
Prdm13 G T 4: 21,679,327 H388N unknown Het
Pwwp2b T C 7: 139,255,183 V180A probably damaging Het
Reep4 T A 14: 70,546,511 S23T probably damaging Het
Rusc2 T A 4: 43,425,378 L1161Q probably damaging Het
Scgb1b3 G A 7: 31,375,979 probably null Het
Scn10a G T 9: 119,670,389 N279K probably benign Het
Smurf2 A G 11: 106,824,752 L643S probably damaging Het
Sox12 G A 2: 152,397,272 P143S unknown Het
Specc1 C T 11: 62,118,675 T339I possibly damaging Het
Tas2r139 T C 6: 42,141,786 V284A probably benign Het
Thumpd3 T A 6: 113,063,146 C330* probably null Het
Ttc26 T A 6: 38,405,945 H338Q probably damaging Het
Ttn A G 2: 76,706,954 S34877P possibly damaging Het
Zfp568 T C 7: 29,998,204 S104P possibly damaging Het
Zfp933 G A 4: 147,828,453 H50Y possibly damaging Het
Other mutations in Bhlhe40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Bhlhe40 APN 6 108661178 missense probably benign 0.25
IGL01146:Bhlhe40 APN 6 108664940 missense possibly damaging 0.60
IGL02950:Bhlhe40 APN 6 108664542 missense probably damaging 1.00
teedoff UTSW 6 108664857 frame shift probably null
R0360:Bhlhe40 UTSW 6 108664750 missense probably damaging 1.00
R1486:Bhlhe40 UTSW 6 108664929 missense probably damaging 1.00
R5041:Bhlhe40 UTSW 6 108662585 missense probably damaging 0.99
R5179:Bhlhe40 UTSW 6 108665208 missense possibly damaging 0.55
R5913:Bhlhe40 UTSW 6 108665193 missense possibly damaging 0.79
R6281:Bhlhe40 UTSW 6 108664462 splice site probably null
R6283:Bhlhe40 UTSW 6 108665031 missense probably damaging 1.00
R6405:Bhlhe40 UTSW 6 108664857 frame shift probably null
R6406:Bhlhe40 UTSW 6 108664857 frame shift probably null
R6595:Bhlhe40 UTSW 6 108664857 frame shift probably null
R6654:Bhlhe40 UTSW 6 108664857 frame shift probably null
R6656:Bhlhe40 UTSW 6 108664857 frame shift probably null
R6657:Bhlhe40 UTSW 6 108664857 frame shift probably null
R6659:Bhlhe40 UTSW 6 108664857 frame shift probably null
R6734:Bhlhe40 UTSW 6 108664857 frame shift probably null
R6968:Bhlhe40 UTSW 6 108664857 frame shift probably null
R7105:Bhlhe40 UTSW 6 108665036 missense possibly damaging 0.96
R7323:Bhlhe40 UTSW 6 108665281 missense probably benign 0.42
R7395:Bhlhe40 UTSW 6 108664857 frame shift probably null
R7399:Bhlhe40 UTSW 6 108664857 frame shift probably null
R7472:Bhlhe40 UTSW 6 108664857 frame shift probably null
R7563:Bhlhe40 UTSW 6 108664857 frame shift probably null
R7726:Bhlhe40 UTSW 6 108662598 missense probably benign
R8058:Bhlhe40 UTSW 6 108664857 frame shift probably null
R8320:Bhlhe40 UTSW 6 108664857 frame shift probably null
R8380:Bhlhe40 UTSW 6 108664857 frame shift probably null
R8381:Bhlhe40 UTSW 6 108664857 frame shift probably null
R8428:Bhlhe40 UTSW 6 108664857 frame shift probably null
R8431:Bhlhe40 UTSW 6 108664857 frame shift probably null
R8432:Bhlhe40 UTSW 6 108664857 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CCTGAAATCTTCCCAGCTCG -3'
(R):5'- GGAACCCATCAGATCACTGC -3'

Sequencing Primer
(F):5'- TGCTTCCAGGAAACCATTGG -3'
(R):5'- TCAGATCACTGCCCGCGAAG -3'
Posted On2020-07-28