Incidental Mutation 'R8319:Bhlhe40'
ID 641851
Institutional Source Beutler Lab
Gene Symbol Bhlhe40
Ensembl Gene ENSMUSG00000030103
Gene Name basic helix-loop-helix family, member e40
Synonyms C130042M06Rik, Clast5, DEC1, CR8, Stra14, cytokine response gene 8, Sharp2, eip1 (E47 interaction protein 1), Bhlhb2, Stra13
MMRRC Submission 067856-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8319 (G1)
Quality Score 217.468
Status Not validated
Chromosome 6
Chromosomal Location 108637590-108643886 bp(+) (GRCm39)
Type of Mutation frame shift
DNA Base Change (assembly) TG to TGG at 108641818 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change at position 254 (254)
Ref Sequence ENSEMBL: ENSMUSP00000032194 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032194] [ENSMUST00000163617]
AlphaFold O35185
Predicted Effect probably null
Transcript: ENSMUST00000032194
AA Change: 254
SMART Domains Protein: ENSMUSP00000032194
Gene: ENSMUSG00000030103
AA Change: 254

DomainStartEndE-ValueType
HLH 58 113 2.52e-11 SMART
ORANGE 140 184 5.91e-13 SMART
low complexity region 230 248 N/A INTRINSIC
low complexity region 372 399 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137478
Predicted Effect probably benign
Transcript: ENSMUST00000163617
SMART Domains Protein: ENSMUSP00000132157
Gene: ENSMUSG00000030103

DomainStartEndE-ValueType
HLH 58 113 2.52e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166346
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204550
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a basic helix-loop-helix protein expressed in various tissues. The encoded protein can interact with Arntl or compete for E-box binding sites in the promoter of Per1 and repress Clock/Arntl's transactivation of Per1. This gene is believed to be involved in the control of circadian rhythm and cell differentiation. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygous mutation of this gene results in impaired immune function and hyperplasia of the lymphoid organs. Aging mutant animals exhibit autoimmune disease. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(2) Targeted, other(2)

Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik A T 13: 59,838,486 (GRCm39) D115E probably benign Het
Abcc1 T A 16: 14,214,315 (GRCm39) L197Q probably damaging Het
Adamts14 T G 10: 61,057,706 (GRCm39) N547T probably benign Het
Ampd3 T A 7: 110,394,982 (GRCm39) S301R probably benign Het
Atg9a G A 1: 75,162,342 (GRCm39) Q523* probably null Het
Atl1 A T 12: 70,002,093 (GRCm39) T351S probably damaging Het
Cacna1c T C 6: 118,614,735 (GRCm39) I1315V Het
Col12a1 C T 9: 79,555,979 (GRCm39) G2013R probably damaging Het
Cpne2 A G 8: 95,280,040 (GRCm39) D153G probably benign Het
Cryzl1 T C 16: 91,489,251 (GRCm39) S205G probably benign Het
Cux1 C T 5: 136,594,251 (GRCm39) A5T probably benign Het
Ddx60 T C 8: 62,395,669 (GRCm39) probably null Het
Dnajc13 G A 9: 104,067,590 (GRCm39) P1190S probably benign Het
Fbxw7 T A 3: 84,881,859 (GRCm39) V526E Het
Fig4 C A 10: 41,139,097 (GRCm39) G369C probably damaging Het
Gabra1 C T 11: 42,026,315 (GRCm39) A326T probably damaging Het
Gbe1 G A 16: 70,284,964 (GRCm39) G429S probably benign Het
Gtf3c5 A T 2: 28,460,506 (GRCm39) H364Q probably benign Het
Hcfc2 T A 10: 82,574,201 (GRCm39) I125N probably damaging Het
Hnrnpul1 A T 7: 25,453,902 (GRCm39) D53E probably benign Het
Ift56 T A 6: 38,382,880 (GRCm39) H338Q probably damaging Het
Il18 A T 9: 50,492,818 (GRCm39) D128V possibly damaging Het
Intu T A 3: 40,608,202 (GRCm39) S71R probably damaging Het
Klhl6 T C 16: 19,775,940 (GRCm39) E206G possibly damaging Het
Lcor T A 19: 41,571,343 (GRCm39) S179T probably damaging Het
Mcub A G 3: 129,727,328 (GRCm39) F93L probably damaging Het
Mdga2 T C 12: 67,267,803 (GRCm39) Y5C unknown Het
Naip1 C A 13: 100,565,721 (GRCm39) V354L probably benign Het
Naip5 A G 13: 100,358,167 (GRCm39) V1023A probably benign Het
Ndufaf1 A G 2: 119,490,568 (GRCm39) L166P probably damaging Het
Ninl A T 2: 150,801,827 (GRCm39) L147H probably damaging Het
Or4c12 A G 2: 89,774,024 (GRCm39) V145A possibly damaging Het
Or51b17 A G 7: 103,542,636 (GRCm39) I102T probably damaging Het
Otogl C T 10: 107,689,127 (GRCm39) probably null Het
Otulin AT ATT 15: 27,606,404 (GRCm39) probably null Het
Phf11b A C 14: 59,576,146 (GRCm39) L30R probably damaging Het
Prdm13 G T 4: 21,679,327 (GRCm39) H388N unknown Het
Pwwp2b T C 7: 138,835,099 (GRCm39) V180A probably damaging Het
Reep4 T A 14: 70,783,951 (GRCm39) S23T probably damaging Het
Rusc2 T A 4: 43,425,378 (GRCm39) L1161Q probably damaging Het
Scgb1b3 G A 7: 31,075,404 (GRCm39) probably null Het
Scn10a G T 9: 119,499,455 (GRCm39) N279K probably benign Het
Smurf2 A G 11: 106,715,578 (GRCm39) L643S probably damaging Het
Sox12 G A 2: 152,239,192 (GRCm39) P143S unknown Het
Specc1 C T 11: 62,009,501 (GRCm39) T339I possibly damaging Het
Tas2r139 T C 6: 42,118,720 (GRCm39) V284A probably benign Het
Thumpd3 T A 6: 113,040,107 (GRCm39) C330* probably null Het
Ttn A G 2: 76,537,298 (GRCm39) S34877P possibly damaging Het
Zfp568 T C 7: 29,697,629 (GRCm39) S104P possibly damaging Het
Zfp933 G A 4: 147,912,910 (GRCm39) H50Y possibly damaging Het
Other mutations in Bhlhe40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Bhlhe40 APN 6 108,638,139 (GRCm39) missense probably benign 0.25
IGL01146:Bhlhe40 APN 6 108,641,901 (GRCm39) missense possibly damaging 0.60
IGL02950:Bhlhe40 APN 6 108,641,503 (GRCm39) missense probably damaging 1.00
teedoff UTSW 6 108,641,818 (GRCm39) frame shift probably null
R0360:Bhlhe40 UTSW 6 108,641,711 (GRCm39) missense probably damaging 1.00
R1486:Bhlhe40 UTSW 6 108,641,890 (GRCm39) missense probably damaging 1.00
R5041:Bhlhe40 UTSW 6 108,639,546 (GRCm39) missense probably damaging 0.99
R5179:Bhlhe40 UTSW 6 108,642,169 (GRCm39) missense possibly damaging 0.55
R5913:Bhlhe40 UTSW 6 108,642,154 (GRCm39) missense possibly damaging 0.79
R6281:Bhlhe40 UTSW 6 108,641,423 (GRCm39) splice site probably null
R6283:Bhlhe40 UTSW 6 108,641,992 (GRCm39) missense probably damaging 1.00
R6405:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R6406:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R6595:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R6654:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R6656:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R6657:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R6659:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R6734:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R6968:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R7105:Bhlhe40 UTSW 6 108,641,997 (GRCm39) missense possibly damaging 0.96
R7323:Bhlhe40 UTSW 6 108,642,242 (GRCm39) missense probably benign 0.42
R7395:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R7399:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R7472:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R7563:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R7726:Bhlhe40 UTSW 6 108,639,559 (GRCm39) missense probably benign
R8058:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R8320:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R8380:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R8381:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R8428:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R8431:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R8432:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R8988:Bhlhe40 UTSW 6 108,639,518 (GRCm39) missense probably damaging 1.00
R9381:Bhlhe40 UTSW 6 108,642,244 (GRCm39) missense probably damaging 1.00
R9582:Bhlhe40 UTSW 6 108,638,467 (GRCm39) missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CCTGAAATCTTCCCAGCTCG -3'
(R):5'- GGAACCCATCAGATCACTGC -3'

Sequencing Primer
(F):5'- TGCTTCCAGGAAACCATTGG -3'
(R):5'- TCAGATCACTGCCCGCGAAG -3'
Posted On 2020-07-28