Incidental Mutation 'R8319:Hnrnpul1'
ID641854
Institutional Source Beutler Lab
Gene Symbol Hnrnpul1
Ensembl Gene ENSMUSG00000040725
Gene Nameheterogeneous nuclear ribonucleoprotein U-like 1
SynonymsE1B-AP5, E130317O14Rik, E1BAP5, Hnrpul1, Hnrnpul
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.577) question?
Stock #R8319 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location25721165-25754757 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 25754477 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 53 (D53E)
Ref Sequence ENSEMBL: ENSMUSP00000146263 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002677] [ENSMUST00000043765] [ENSMUST00000085948] [ENSMUST00000108401] [ENSMUST00000206832]
Predicted Effect probably benign
Transcript: ENSMUST00000002677
SMART Domains Protein: ENSMUSP00000002677
Gene: ENSMUSG00000002602

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 35 124 5.53e-6 SMART
IG 139 218 9.06e-2 SMART
FN3 219 312 9.25e-6 SMART
FN3 328 409 2.18e-2 SMART
transmembrane domain 444 466 N/A INTRINSIC
low complexity region 489 501 N/A INTRINSIC
TyrKc 530 797 1.91e-134 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000043765
SMART Domains Protein: ENSMUSP00000037268
Gene: ENSMUSG00000040725

DomainStartEndE-ValueType
SAP 3 37 2.86e-10 SMART
low complexity region 62 74 N/A INTRINSIC
low complexity region 78 91 N/A INTRINSIC
low complexity region 201 209 N/A INTRINSIC
SPRY 255 388 8.49e-41 SMART
Pfam:AAA_33 424 569 1.4e-29 PFAM
low complexity region 613 626 N/A INTRINSIC
low complexity region 631 693 N/A INTRINSIC
low complexity region 695 718 N/A INTRINSIC
low complexity region 745 765 N/A INTRINSIC
low complexity region 768 859 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000085948
SMART Domains Protein: ENSMUSP00000083110
Gene: ENSMUSG00000002602

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 35 124 5.53e-6 SMART
IG 139 218 9.06e-2 SMART
FN3 219 312 9.25e-6 SMART
FN3 328 409 2.18e-2 SMART
transmembrane domain 435 457 N/A INTRINSIC
low complexity region 480 492 N/A INTRINSIC
TyrKc 521 788 1.91e-134 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108401
AA Change: D53E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000104038
Gene: ENSMUSG00000040725
AA Change: D53E

DomainStartEndE-ValueType
SAP 3 37 2.86e-10 SMART
low complexity region 62 74 N/A INTRINSIC
low complexity region 78 91 N/A INTRINSIC
low complexity region 201 209 N/A INTRINSIC
Pfam:SPRY 255 338 2e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000206832
AA Change: D53E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear RNA-binding protein of the heterogeneous nuclear ribonucleoprotein (hnRNP) family. This protein binds specifically to adenovirus early-1B-55kDa oncoprotein. It may play an important role in nucleocytoplasmic RNA transport, and its function is modulated by early-1B-55kDa in adenovirus-infected cells. [provided by RefSeq, Mar 2016]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik A T 13: 59,690,672 D115E probably benign Het
Abcc1 T A 16: 14,396,451 L197Q probably damaging Het
Adamts14 T G 10: 61,221,927 N547T probably benign Het
Ampd3 T A 7: 110,795,775 S301R probably benign Het
Atg9a G A 1: 75,185,698 Q523* probably null Het
Atl1 A T 12: 69,955,319 T351S probably damaging Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Cacna1c T C 6: 118,637,774 I1315V Het
Ccdc109b A G 3: 129,933,679 F93L probably damaging Het
Col12a1 C T 9: 79,648,697 G2013R probably damaging Het
Cpne2 A G 8: 94,553,412 D153G probably benign Het
Cryzl1 T C 16: 91,692,363 S205G probably benign Het
Cux1 C T 5: 136,565,397 A5T probably benign Het
Ddx60 T C 8: 61,942,635 probably null Het
Dnajc13 G A 9: 104,190,391 P1190S probably benign Het
Fbxw7 T A 3: 84,974,552 V526E Het
Fig4 C A 10: 41,263,101 G369C probably damaging Het
Gabra1 C T 11: 42,135,488 A326T probably damaging Het
Gbe1 G A 16: 70,488,076 G429S probably benign Het
Gm340 T A 19: 41,582,904 S179T probably damaging Het
Gtf3c5 A T 2: 28,570,494 H364Q probably benign Het
Hcfc2 T A 10: 82,738,367 I125N probably damaging Het
Il18 A T 9: 50,581,518 D128V possibly damaging Het
Intu T A 3: 40,653,772 S71R probably damaging Het
Klhl6 T C 16: 19,957,190 E206G possibly damaging Het
Mdga2 T C 12: 67,221,029 Y5C unknown Het
Naip1 C A 13: 100,429,213 V354L probably benign Het
Naip5 A G 13: 100,221,659 V1023A probably benign Het
Ndufaf1 A G 2: 119,660,087 L166P probably damaging Het
Ninl A T 2: 150,959,907 L147H probably damaging Het
Olfr1259 A G 2: 89,943,680 V145A possibly damaging Het
Olfr64 A G 7: 103,893,429 I102T probably damaging Het
Otogl C T 10: 107,853,266 probably null Het
Otulin AT ATT 15: 27,606,318 probably null Het
Phf11b A C 14: 59,338,697 L30R probably damaging Het
Prdm13 G T 4: 21,679,327 H388N unknown Het
Pwwp2b T C 7: 139,255,183 V180A probably damaging Het
Reep4 T A 14: 70,546,511 S23T probably damaging Het
Rusc2 T A 4: 43,425,378 L1161Q probably damaging Het
Scgb1b3 G A 7: 31,375,979 probably null Het
Scn10a G T 9: 119,670,389 N279K probably benign Het
Smurf2 A G 11: 106,824,752 L643S probably damaging Het
Sox12 G A 2: 152,397,272 P143S unknown Het
Specc1 C T 11: 62,118,675 T339I possibly damaging Het
Tas2r139 T C 6: 42,141,786 V284A probably benign Het
Thumpd3 T A 6: 113,063,146 C330* probably null Het
Ttc26 T A 6: 38,405,945 H338Q probably damaging Het
Ttn A G 2: 76,706,954 S34877P possibly damaging Het
Zfp568 T C 7: 29,998,204 S104P possibly damaging Het
Zfp933 G A 4: 147,828,453 H50Y possibly damaging Het
Other mutations in Hnrnpul1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Hnrnpul1 APN 7 25726154 missense possibly damaging 0.74
IGL01287:Hnrnpul1 APN 7 25726898 missense probably damaging 1.00
IGL01409:Hnrnpul1 APN 7 25724652 missense unknown
IGL02026:Hnrnpul1 APN 7 25745162 missense probably damaging 0.99
IGL02073:Hnrnpul1 APN 7 25722341 unclassified probably benign
IGL02474:Hnrnpul1 APN 7 25726757 missense probably benign 0.02
IGL02839:Hnrnpul1 APN 7 25733242 critical splice donor site probably null
IGL02894:Hnrnpul1 APN 7 25750904 missense possibly damaging 0.70
IGL03382:Hnrnpul1 APN 7 25750984 start codon destroyed probably null 0.53
R0011:Hnrnpul1 UTSW 7 25742915 splice site probably benign
R0525:Hnrnpul1 UTSW 7 25740883 missense possibly damaging 0.72
R0587:Hnrnpul1 UTSW 7 25745232 missense possibly damaging 0.70
R1121:Hnrnpul1 UTSW 7 25740907 missense possibly damaging 0.68
R1313:Hnrnpul1 UTSW 7 25722916 unclassified probably benign
R1313:Hnrnpul1 UTSW 7 25722916 unclassified probably benign
R1880:Hnrnpul1 UTSW 7 25733098 missense possibly damaging 0.95
R1892:Hnrnpul1 UTSW 7 25726766 missense probably benign 0.11
R2113:Hnrnpul1 UTSW 7 25733269 missense possibly damaging 0.47
R2194:Hnrnpul1 UTSW 7 25725922 critical splice donor site probably null
R2269:Hnrnpul1 UTSW 7 25750874 missense probably damaging 0.98
R2679:Hnrnpul1 UTSW 7 25726875 missense probably damaging 1.00
R3079:Hnrnpul1 UTSW 7 25733115 nonsense probably null
R3917:Hnrnpul1 UTSW 7 25726875 missense probably damaging 1.00
R4077:Hnrnpul1 UTSW 7 25726875 missense probably damaging 1.00
R4079:Hnrnpul1 UTSW 7 25726875 missense probably damaging 1.00
R4181:Hnrnpul1 UTSW 7 25726812 missense probably damaging 0.98
R4449:Hnrnpul1 UTSW 7 25722284 unclassified probably benign
R4707:Hnrnpul1 UTSW 7 25726833 missense probably damaging 1.00
R4764:Hnrnpul1 UTSW 7 25743011 missense probably benign 0.00
R5040:Hnrnpul1 UTSW 7 25742989 missense possibly damaging 0.86
R5131:Hnrnpul1 UTSW 7 25726794 missense probably benign 0.08
R5224:Hnrnpul1 UTSW 7 25745175 missense probably damaging 0.98
R5599:Hnrnpul1 UTSW 7 25754672 start gained probably benign
R5975:Hnrnpul1 UTSW 7 25754359 missense possibly damaging 0.93
R7032:Hnrnpul1 UTSW 7 25750894 missense probably benign 0.11
R7195:Hnrnpul1 UTSW 7 25724778 missense unknown
R7231:Hnrnpul1 UTSW 7 25748417 nonsense probably null
R7667:Hnrnpul1 UTSW 7 25754421 missense probably damaging 0.99
R8017:Hnrnpul1 UTSW 7 25748464 missense probably benign 0.03
R8060:Hnrnpul1 UTSW 7 25748343 missense possibly damaging 0.54
Z1176:Hnrnpul1 UTSW 7 25724664 missense probably benign 0.23
Z1176:Hnrnpul1 UTSW 7 25724698 missense unknown
Predicted Primers PCR Primer
(F):5'- TCTCCTGGATCTCTGTGGAGTC -3'
(R):5'- TCCTGACAGGCAAGGTTTAGGG -3'

Sequencing Primer
(F):5'- ATCTCTGTGGAGTCGAGCTC -3'
(R):5'- ACAGAGCCCTGGGAGGC -3'
Posted On2020-07-28