Incidental Mutation 'R8319:Zfp568'
ID641855
Institutional Source Beutler Lab
Gene Symbol Zfp568
Ensembl Gene ENSMUSG00000074221
Gene Namezinc finger protein 568
Synonymschato, LOC381866
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8319 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location29983955-30028282 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 29998204 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 104 (S104P)
Ref Sequence ENSEMBL: ENSMUSP00000118387 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074322] [ENSMUST00000146074] [ENSMUST00000148442] [ENSMUST00000177931] [ENSMUST00000207940]
Predicted Effect possibly damaging
Transcript: ENSMUST00000074322
AA Change: S104P

PolyPhen 2 Score 0.720 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000073930
Gene: ENSMUSG00000074221
AA Change: S104P

DomainStartEndE-ValueType
KRAB 34 94 2.73e-39 SMART
KRAB 124 184 2.01e-28 SMART
ZnF_C2H2 363 385 7.78e-3 SMART
ZnF_C2H2 391 413 3.95e-4 SMART
ZnF_C2H2 419 441 3.44e-4 SMART
ZnF_C2H2 447 469 2.2e-2 SMART
ZnF_C2H2 475 497 6.67e-2 SMART
ZnF_C2H2 503 525 6.32e-3 SMART
ZnF_C2H2 531 553 4.87e-4 SMART
ZnF_C2H2 559 581 2.09e-3 SMART
ZnF_C2H2 587 609 2.95e-3 SMART
ZnF_C2H2 615 637 3.69e-4 SMART
ZnF_C2H2 643 665 1.12e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000146074
AA Change: S104P

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000118823
Gene: ENSMUSG00000074221
AA Change: S104P

DomainStartEndE-ValueType
KRAB 34 94 2.73e-39 SMART
KRAB 123 183 2.01e-28 SMART
ZnF_C2H2 362 384 7.78e-3 SMART
ZnF_C2H2 390 412 3.95e-4 SMART
ZnF_C2H2 418 440 3.44e-4 SMART
ZnF_C2H2 446 468 2.2e-2 SMART
ZnF_C2H2 474 496 6.67e-2 SMART
ZnF_C2H2 502 524 6.32e-3 SMART
ZnF_C2H2 530 552 4.87e-4 SMART
ZnF_C2H2 558 580 2.09e-3 SMART
ZnF_C2H2 586 608 2.95e-3 SMART
ZnF_C2H2 614 636 3.69e-4 SMART
ZnF_C2H2 642 664 1.12e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000148442
AA Change: S104P

PolyPhen 2 Score 0.720 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000118387
Gene: ENSMUSG00000074221
AA Change: S104P

DomainStartEndE-ValueType
KRAB 34 94 2.73e-39 SMART
KRAB 124 184 2.01e-28 SMART
ZnF_C2H2 363 385 7.78e-3 SMART
ZnF_C2H2 391 413 3.95e-4 SMART
ZnF_C2H2 419 441 3.44e-4 SMART
ZnF_C2H2 447 469 2.2e-2 SMART
ZnF_C2H2 475 497 6.67e-2 SMART
ZnF_C2H2 503 525 6.32e-3 SMART
ZnF_C2H2 531 553 4.87e-4 SMART
ZnF_C2H2 559 581 2.09e-3 SMART
ZnF_C2H2 587 609 2.95e-3 SMART
ZnF_C2H2 615 637 3.69e-4 SMART
ZnF_C2H2 643 665 1.12e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000177931
AA Change: S104P

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000137438
Gene: ENSMUSG00000074221
AA Change: S104P

DomainStartEndE-ValueType
KRAB 34 94 2.73e-39 SMART
KRAB 123 183 2.01e-28 SMART
ZnF_C2H2 362 384 7.78e-3 SMART
ZnF_C2H2 390 412 3.95e-4 SMART
ZnF_C2H2 418 440 3.44e-4 SMART
ZnF_C2H2 446 468 2.2e-2 SMART
ZnF_C2H2 474 496 6.67e-2 SMART
ZnF_C2H2 502 524 6.32e-3 SMART
ZnF_C2H2 530 552 4.87e-4 SMART
ZnF_C2H2 558 580 2.09e-3 SMART
ZnF_C2H2 586 608 2.95e-3 SMART
ZnF_C2H2 614 636 3.69e-4 SMART
ZnF_C2H2 642 664 1.12e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000207940
AA Change: S104P

PolyPhen 2 Score 0.720 (Sensitivity: 0.86; Specificity: 0.92)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mutants are embryonic lethal with growth arrest around E8.5-9.0. Mutant embryo shows shortened anterior-posterior axial extension with defects in somites and midline structures including open gut tube, cardia bifida, and failure to closeneural tube. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik A T 13: 59,690,672 D115E probably benign Het
Abcc1 T A 16: 14,396,451 L197Q probably damaging Het
Adamts14 T G 10: 61,221,927 N547T probably benign Het
Ampd3 T A 7: 110,795,775 S301R probably benign Het
Atg9a G A 1: 75,185,698 Q523* probably null Het
Atl1 A T 12: 69,955,319 T351S probably damaging Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Cacna1c T C 6: 118,637,774 I1315V Het
Ccdc109b A G 3: 129,933,679 F93L probably damaging Het
Col12a1 C T 9: 79,648,697 G2013R probably damaging Het
Cpne2 A G 8: 94,553,412 D153G probably benign Het
Cryzl1 T C 16: 91,692,363 S205G probably benign Het
Cux1 C T 5: 136,565,397 A5T probably benign Het
Ddx60 T C 8: 61,942,635 probably null Het
Dnajc13 G A 9: 104,190,391 P1190S probably benign Het
Fbxw7 T A 3: 84,974,552 V526E Het
Fig4 C A 10: 41,263,101 G369C probably damaging Het
Gabra1 C T 11: 42,135,488 A326T probably damaging Het
Gbe1 G A 16: 70,488,076 G429S probably benign Het
Gm340 T A 19: 41,582,904 S179T probably damaging Het
Gtf3c5 A T 2: 28,570,494 H364Q probably benign Het
Hcfc2 T A 10: 82,738,367 I125N probably damaging Het
Hnrnpul1 A T 7: 25,754,477 D53E probably benign Het
Il18 A T 9: 50,581,518 D128V possibly damaging Het
Intu T A 3: 40,653,772 S71R probably damaging Het
Klhl6 T C 16: 19,957,190 E206G possibly damaging Het
Mdga2 T C 12: 67,221,029 Y5C unknown Het
Naip1 C A 13: 100,429,213 V354L probably benign Het
Naip5 A G 13: 100,221,659 V1023A probably benign Het
Ndufaf1 A G 2: 119,660,087 L166P probably damaging Het
Ninl A T 2: 150,959,907 L147H probably damaging Het
Olfr1259 A G 2: 89,943,680 V145A possibly damaging Het
Olfr64 A G 7: 103,893,429 I102T probably damaging Het
Otogl C T 10: 107,853,266 probably null Het
Otulin AT ATT 15: 27,606,318 probably null Het
Phf11b A C 14: 59,338,697 L30R probably damaging Het
Prdm13 G T 4: 21,679,327 H388N unknown Het
Pwwp2b T C 7: 139,255,183 V180A probably damaging Het
Reep4 T A 14: 70,546,511 S23T probably damaging Het
Rusc2 T A 4: 43,425,378 L1161Q probably damaging Het
Scgb1b3 G A 7: 31,375,979 probably null Het
Scn10a G T 9: 119,670,389 N279K probably benign Het
Smurf2 A G 11: 106,824,752 L643S probably damaging Het
Sox12 G A 2: 152,397,272 P143S unknown Het
Specc1 C T 11: 62,118,675 T339I possibly damaging Het
Tas2r139 T C 6: 42,141,786 V284A probably benign Het
Thumpd3 T A 6: 113,063,146 C330* probably null Het
Ttc26 T A 6: 38,405,945 H338Q probably damaging Het
Ttn A G 2: 76,706,954 S34877P possibly damaging Het
Zfp933 G A 4: 147,828,453 H50Y possibly damaging Het
Other mutations in Zfp568
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00573:Zfp568 APN 7 30022440 missense possibly damaging 0.66
IGL00792:Zfp568 APN 7 30015072 missense probably benign 0.00
IGL01133:Zfp568 APN 7 29987808 critical splice donor site probably null
IGL01330:Zfp568 APN 7 30022277 missense probably benign 0.01
IGL03157:Zfp568 APN 7 30022764 missense probably damaging 1.00
R0739:Zfp568 UTSW 7 30023321 missense probably damaging 1.00
R1051:Zfp568 UTSW 7 30022529 nonsense probably null
R1967:Zfp568 UTSW 7 29989088 missense probably damaging 0.99
R2038:Zfp568 UTSW 7 29989082 missense probably null 1.00
R3874:Zfp568 UTSW 7 30023396 missense probably damaging 1.00
R4438:Zfp568 UTSW 7 30022296 missense probably benign
R4584:Zfp568 UTSW 7 29998192 missense probably benign 0.04
R4667:Zfp568 UTSW 7 30023277 missense probably damaging 1.00
R4669:Zfp568 UTSW 7 30023277 missense probably damaging 1.00
R4773:Zfp568 UTSW 7 29997770 missense probably damaging 1.00
R4791:Zfp568 UTSW 7 30015183 missense probably damaging 1.00
R5250:Zfp568 UTSW 7 30017230 missense probably benign 0.12
R5541:Zfp568 UTSW 7 30022876 missense possibly damaging 0.81
R5956:Zfp568 UTSW 7 29997863 missense probably damaging 1.00
R6444:Zfp568 UTSW 7 30017257 missense probably benign 0.01
R6600:Zfp568 UTSW 7 30022523 missense possibly damaging 0.71
R7299:Zfp568 UTSW 7 30017244 missense probably benign 0.34
R7316:Zfp568 UTSW 7 30022256 missense possibly damaging 0.95
R7562:Zfp568 UTSW 7 30023256 missense probably benign 0.04
R7664:Zfp568 UTSW 7 30022290 missense probably benign
R7672:Zfp568 UTSW 7 29997787 missense probably damaging 0.99
R7759:Zfp568 UTSW 7 30023414 missense possibly damaging 0.66
R7790:Zfp568 UTSW 7 30022725 missense probably damaging 1.00
R7811:Zfp568 UTSW 7 29997870 missense possibly damaging 0.95
R8110:Zfp568 UTSW 7 30023126 missense probably damaging 1.00
R8194:Zfp568 UTSW 7 30023333 missense probably damaging 1.00
R8254:Zfp568 UTSW 7 30015133 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- TGTGTCACTGTGTCAGTTCC -3'
(R):5'- CCAATAGGGCAGAGACATTCC -3'

Sequencing Primer
(F):5'- GTGTCACTGTGTCAGTTCCTTGATTC -3'
(R):5'- TAGGGCAGAGACATTCCTAGAATAG -3'
Posted On2020-07-28