Incidental Mutation 'R8319:Ampd3'
ID641858
Institutional Source Beutler Lab
Gene Symbol Ampd3
Ensembl Gene ENSMUSG00000005686
Gene Nameadenosine monophosphate deaminase 3
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8319 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location110768206-110812405 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 110795775 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 301 (S301R)
Ref Sequence ENSEMBL: ENSMUSP00000005829 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005829] [ENSMUST00000148292] [ENSMUST00000170374]
Predicted Effect probably benign
Transcript: ENSMUST00000005829
AA Change: S301R

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000005829
Gene: ENSMUSG00000005686
AA Change: S301R

DomainStartEndE-ValueType
low complexity region 99 111 N/A INTRINSIC
Pfam:A_deaminase 309 716 1.5e-139 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148292
SMART Domains Protein: ENSMUSP00000122657
Gene: ENSMUSG00000005686

DomainStartEndE-ValueType
low complexity region 99 111 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170374
AA Change: S301R

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000130495
Gene: ENSMUSG00000005686
AA Change: S301R

DomainStartEndE-ValueType
low complexity region 99 111 N/A INTRINSIC
Pfam:A_deaminase 309 716 7.6e-129 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176210
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the adenosine and AMP deaminases family. The encoded protein is an AMP deaminase involved in nucleotide and energy metabolism in erythrocytes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased mean corpuscular volume, abnormal erythrocyte physiology including increased erythrocyte ATP levels and osmotic fragility after fasting, and increased lung inflammation after hind-limb ischemia andreperfusion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik A T 13: 59,690,672 D115E probably benign Het
Abcc1 T A 16: 14,396,451 L197Q probably damaging Het
Adamts14 T G 10: 61,221,927 N547T probably benign Het
Atg9a G A 1: 75,185,698 Q523* probably null Het
Atl1 A T 12: 69,955,319 T351S probably damaging Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Cacna1c T C 6: 118,637,774 I1315V Het
Ccdc109b A G 3: 129,933,679 F93L probably damaging Het
Col12a1 C T 9: 79,648,697 G2013R probably damaging Het
Cpne2 A G 8: 94,553,412 D153G probably benign Het
Cryzl1 T C 16: 91,692,363 S205G probably benign Het
Cux1 C T 5: 136,565,397 A5T probably benign Het
Ddx60 T C 8: 61,942,635 probably null Het
Dnajc13 G A 9: 104,190,391 P1190S probably benign Het
Fbxw7 T A 3: 84,974,552 V526E Het
Fig4 C A 10: 41,263,101 G369C probably damaging Het
Gabra1 C T 11: 42,135,488 A326T probably damaging Het
Gbe1 G A 16: 70,488,076 G429S probably benign Het
Gm340 T A 19: 41,582,904 S179T probably damaging Het
Gtf3c5 A T 2: 28,570,494 H364Q probably benign Het
Hcfc2 T A 10: 82,738,367 I125N probably damaging Het
Hnrnpul1 A T 7: 25,754,477 D53E probably benign Het
Il18 A T 9: 50,581,518 D128V possibly damaging Het
Intu T A 3: 40,653,772 S71R probably damaging Het
Klhl6 T C 16: 19,957,190 E206G possibly damaging Het
Mdga2 T C 12: 67,221,029 Y5C unknown Het
Naip1 C A 13: 100,429,213 V354L probably benign Het
Naip5 A G 13: 100,221,659 V1023A probably benign Het
Ndufaf1 A G 2: 119,660,087 L166P probably damaging Het
Ninl A T 2: 150,959,907 L147H probably damaging Het
Olfr1259 A G 2: 89,943,680 V145A possibly damaging Het
Olfr64 A G 7: 103,893,429 I102T probably damaging Het
Otogl C T 10: 107,853,266 probably null Het
Otulin AT ATT 15: 27,606,318 probably null Het
Phf11b A C 14: 59,338,697 L30R probably damaging Het
Prdm13 G T 4: 21,679,327 H388N unknown Het
Pwwp2b T C 7: 139,255,183 V180A probably damaging Het
Reep4 T A 14: 70,546,511 S23T probably damaging Het
Rusc2 T A 4: 43,425,378 L1161Q probably damaging Het
Scgb1b3 G A 7: 31,375,979 probably null Het
Scn10a G T 9: 119,670,389 N279K probably benign Het
Smurf2 A G 11: 106,824,752 L643S probably damaging Het
Sox12 G A 2: 152,397,272 P143S unknown Het
Specc1 C T 11: 62,118,675 T339I possibly damaging Het
Tas2r139 T C 6: 42,141,786 V284A probably benign Het
Thumpd3 T A 6: 113,063,146 C330* probably null Het
Ttc26 T A 6: 38,405,945 H338Q probably damaging Het
Ttn A G 2: 76,706,954 S34877P possibly damaging Het
Zfp568 T C 7: 29,998,204 S104P possibly damaging Het
Zfp933 G A 4: 147,828,453 H50Y possibly damaging Het
Other mutations in Ampd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Ampd3 APN 7 110803147 missense probably benign 0.01
IGL00576:Ampd3 APN 7 110788821 splice site probably benign
IGL00805:Ampd3 APN 7 110809865 missense possibly damaging 0.78
IGL01486:Ampd3 APN 7 110809916 splice site probably benign
IGL01551:Ampd3 APN 7 110804976 missense probably damaging 1.00
IGL02088:Ampd3 APN 7 110793686 missense probably benign 0.00
IGL02123:Ampd3 APN 7 110802559 missense possibly damaging 0.91
IGL02605:Ampd3 APN 7 110795758 missense probably benign 0.00
IGL02990:Ampd3 APN 7 110807963 splice site probably benign
carson UTSW 7 110800710 missense probably damaging 1.00
commanche UTSW 7 110807871 missense possibly damaging 0.95
guangdong UTSW 7 110803162 missense probably damaging 1.00
penasco UTSW 7 110803226 missense probably damaging 1.00
taos UTSW 7 110804935 missense probably damaging 0.99
R0025:Ampd3 UTSW 7 110793669 missense probably benign 0.04
R0025:Ampd3 UTSW 7 110793669 missense probably benign 0.04
R0608:Ampd3 UTSW 7 110795790 missense probably damaging 1.00
R0608:Ampd3 UTSW 7 110795791 missense probably damaging 1.00
R0718:Ampd3 UTSW 7 110777808 missense probably damaging 1.00
R0799:Ampd3 UTSW 7 110800697 missense probably damaging 1.00
R1053:Ampd3 UTSW 7 110788680 missense probably damaging 1.00
R1473:Ampd3 UTSW 7 110804935 missense probably damaging 0.99
R1676:Ampd3 UTSW 7 110795733 missense probably damaging 1.00
R1977:Ampd3 UTSW 7 110803162 missense probably damaging 1.00
R2380:Ampd3 UTSW 7 110800710 missense probably damaging 1.00
R2419:Ampd3 UTSW 7 110768369 unclassified probably benign
R3438:Ampd3 UTSW 7 110803226 missense probably damaging 1.00
R3907:Ampd3 UTSW 7 110793670 missense possibly damaging 0.88
R5367:Ampd3 UTSW 7 110807871 missense possibly damaging 0.95
R5625:Ampd3 UTSW 7 110802523 missense probably damaging 0.97
R6066:Ampd3 UTSW 7 110793767 missense probably benign 0.12
R6267:Ampd3 UTSW 7 110791180 splice site probably null
R6493:Ampd3 UTSW 7 110795811 splice site probably null
R6852:Ampd3 UTSW 7 110802546 missense probably benign 0.02
R7147:Ampd3 UTSW 7 110804852 missense probably damaging 1.00
R7313:Ampd3 UTSW 7 110806054 missense probably damaging 1.00
R7649:Ampd3 UTSW 7 110777842 missense probably benign 0.01
R7843:Ampd3 UTSW 7 110791188 missense probably benign 0.01
R7946:Ampd3 UTSW 7 110777940 missense probably damaging 1.00
R8377:Ampd3 UTSW 7 110800730 missense probably damaging 1.00
Z1088:Ampd3 UTSW 7 110777825 missense probably damaging 1.00
Z1177:Ampd3 UTSW 7 110788780 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGAAGCATCTCGGCTCTTC -3'
(R):5'- CAGGCATGTTTTATCACACAGGC -3'

Sequencing Primer
(F):5'- TCCATGCTGTCAGAACCTG -3'
(R):5'- ATGTTTTATCACACAGGCTACTCCAG -3'
Posted On2020-07-28