Incidental Mutation 'R0109:Olfr1241'
ID64186
Institutional Source Beutler Lab
Gene Symbol Olfr1241
Ensembl Gene ENSMUSG00000075086
Gene Nameolfactory receptor 1241
SynonymsMOR231-14, GA_x6K02T2Q125-50926215-50925271
MMRRC Submission 038395-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R0109 (G1)
Quality Score153
Status Not validated
Chromosome2
Chromosomal Location89481314-89487126 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 89482803 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 111 (F111L)
Ref Sequence ENSEMBL: ENSMUSP00000149914 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099778] [ENSMUST00000214743] [ENSMUST00000215055]
Predicted Effect probably benign
Transcript: ENSMUST00000099778
AA Change: F111L

PolyPhen 2 Score 0.101 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000097366
Gene: ENSMUSG00000075086
AA Change: F111L

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 1.5e-46 PFAM
Pfam:7tm_1 39 285 8.5e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214743
AA Change: F111L

PolyPhen 2 Score 0.101 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000215055
AA Change: F111L

PolyPhen 2 Score 0.101 (Sensitivity: 0.93; Specificity: 0.86)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A T 7: 120,318,762 K1496* probably null Het
Anapc1 C A 2: 128,634,693 R1335L probably damaging Het
Arhgef10l A T 4: 140,578,294 S203T probably benign Het
Astn1 C T 1: 158,664,104 T41I possibly damaging Het
Avil A G 10: 127,013,644 N603S probably benign Het
Brca1 T C 11: 101,531,090 D149G possibly damaging Het
Col19a1 A C 1: 24,559,768 probably null Het
Cps1 T C 1: 67,229,418 V1435A possibly damaging Het
Cyp2j6 A T 4: 96,518,157 I459N probably damaging Het
Cyth1 T C 11: 118,182,306 E242G probably damaging Het
Dclk3 T G 9: 111,467,670 L94R possibly damaging Het
Dsg3 T C 18: 20,540,134 V954A probably damaging Het
Dync2h1 T A 9: 7,111,487 D309V probably damaging Het
Efhd2 A G 4: 141,874,567 F101L probably benign Het
Fgd5 T A 6: 91,988,235 M325K possibly damaging Het
Fras1 T C 5: 96,710,077 S2077P probably benign Het
Frmpd1 A T 4: 45,279,340 E688D probably benign Het
Hspg2 T C 4: 137,562,201 V3824A probably benign Het
Kctd16 A G 18: 40,259,151 E264G probably benign Het
Mapk15 A T 15: 75,996,077 K153* probably null Het
Miox G A 15: 89,335,581 V91I probably benign Het
Nfyb G A 10: 82,755,002 A65V possibly damaging Het
Olfr1442 C A 19: 12,674,860 F218L probably benign Het
Olfr646 T C 7: 104,106,605 S109P probably damaging Het
Parp9 T C 16: 35,948,341 I64T probably damaging Het
Pfkfb4 T C 9: 108,998,889 V43A probably benign Het
Pgap1 A T 1: 54,494,825 V643E probably damaging Het
Pip5k1b T A 19: 24,379,047 M176L probably benign Het
Ppfia4 A T 1: 134,324,217 probably null Het
Prdx2 G A 8: 84,970,251 G4S probably benign Het
Rin3 A G 12: 102,313,081 I50V possibly damaging Het
Rtl1 G A 12: 109,595,407 probably benign Het
Sgsm3 G C 15: 81,009,466 D434H probably damaging Het
Shank2 T C 7: 144,410,577 S634P possibly damaging Het
Sik2 A G 9: 50,899,475 M447T possibly damaging Het
Sla2 A G 2: 156,883,587 probably null Het
Spata16 T A 3: 26,913,267 F389I probably damaging Het
Srebf1 G A 11: 60,201,804 A793V probably benign Het
Tmed11 T A 5: 108,777,412 D178V probably damaging Het
Traf7 A G 17: 24,513,926 F110L probably benign Het
Ttn T A 2: 76,725,564 I30366F probably damaging Het
Ubqlnl C T 7: 104,150,192 V33M probably damaging Het
Vmn1r194 A G 13: 22,245,047 Y278C probably damaging Het
Vmn2r100 C A 17: 19,522,120 P252Q possibly damaging Het
Vmn2r114 A T 17: 23,310,575 Y184* probably null Het
Vmn2r53 C T 7: 12,582,066 A609T probably damaging Het
Vps13b A G 15: 35,572,119 T961A probably benign Het
Xirp2 T A 2: 67,519,278 N3272K probably damaging Het
Zfp217 C T 2: 170,115,462 A539T probably benign Het
Zfp454 T A 11: 50,883,775 T24S possibly damaging Het
Other mutations in Olfr1241
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01289:Olfr1241 APN 2 89482847 missense probably benign 0.38
IGL02175:Olfr1241 APN 2 89482282 missense possibly damaging 0.96
IGL02625:Olfr1241 APN 2 89482674 missense probably damaging 1.00
R0109:Olfr1241 UTSW 2 89482803 missense probably benign 0.10
R1468:Olfr1241 UTSW 2 89482511 missense possibly damaging 0.94
R1468:Olfr1241 UTSW 2 89482511 missense possibly damaging 0.94
R1511:Olfr1241 UTSW 2 89482248 missense probably null 0.01
R1527:Olfr1241 UTSW 2 89482532 missense probably benign 0.10
R1528:Olfr1241 UTSW 2 89482553 missense probably damaging 1.00
R1585:Olfr1241 UTSW 2 89482971 missense probably benign 0.00
R2483:Olfr1241 UTSW 2 89483127 nonsense probably null
R2972:Olfr1241 UTSW 2 89482776 missense possibly damaging 0.52
R3692:Olfr1241 UTSW 2 89482896 missense probably benign
R4592:Olfr1241 UTSW 2 89482756 missense probably damaging 1.00
R4883:Olfr1241 UTSW 2 89482308 missense probably benign
R7104:Olfr1241 UTSW 2 89483114 missense possibly damaging 0.70
R7347:Olfr1241 UTSW 2 89482455 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TTGCTCCACCATTGGCAACCAC -3'
(R):5'- ACAGTCATAGCCAGTCCCTCCTTAG -3'

Sequencing Primer
(F):5'- GTCCTAATAATGGGTACATGTCACAG -3'
(R):5'- AGGGACTCCAATGTACTTCTTC -3'
Posted On2013-08-06