Incidental Mutation 'R8319:Ddx60'
ID641860
Institutional Source Beutler Lab
Gene Symbol Ddx60
Ensembl Gene ENSMUSG00000037921
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 60
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.136) question?
Stock #R8319 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location61928087-62038244 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 61942635 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000091197 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070631] [ENSMUST00000093485] [ENSMUST00000154398] [ENSMUST00000156980]
Predicted Effect probably benign
Transcript: ENSMUST00000070631
SMART Domains Protein: ENSMUSP00000070741
Gene: ENSMUSG00000037921

DomainStartEndE-ValueType
low complexity region 99 110 N/A INTRINSIC
low complexity region 364 376 N/A INTRINSIC
DEXDc 758 949 1.05e-15 SMART
Blast:DEXDc 1007 1132 4e-24 BLAST
HELICc 1245 1328 4.35e-13 SMART
low complexity region 1362 1373 N/A INTRINSIC
Blast:DEXDc 1503 1584 1e-20 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000093485
SMART Domains Protein: ENSMUSP00000091197
Gene: ENSMUSG00000037921

DomainStartEndE-ValueType
low complexity region 99 110 N/A INTRINSIC
low complexity region 364 376 N/A INTRINSIC
DEXDc 759 950 1.05e-15 SMART
Blast:DEXDc 1008 1133 4e-24 BLAST
HELICc 1246 1329 4.35e-13 SMART
low complexity region 1363 1374 N/A INTRINSIC
Blast:DEXDc 1504 1585 1e-20 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000154398
SMART Domains Protein: ENSMUSP00000122841
Gene: ENSMUSG00000037921

DomainStartEndE-ValueType
low complexity region 99 110 N/A INTRINSIC
low complexity region 364 376 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156980
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal immunity to several viruses (IAV, EMCV, SINV) but increased susceptibility to VSV infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik A T 13: 59,690,672 D115E probably benign Het
Abcc1 T A 16: 14,396,451 L197Q probably damaging Het
Adamts14 T G 10: 61,221,927 N547T probably benign Het
Ampd3 T A 7: 110,795,775 S301R probably benign Het
Atg9a G A 1: 75,185,698 Q523* probably null Het
Atl1 A T 12: 69,955,319 T351S probably damaging Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Cacna1c T C 6: 118,637,774 I1315V Het
Ccdc109b A G 3: 129,933,679 F93L probably damaging Het
Col12a1 C T 9: 79,648,697 G2013R probably damaging Het
Cpne2 A G 8: 94,553,412 D153G probably benign Het
Cryzl1 T C 16: 91,692,363 S205G probably benign Het
Cux1 C T 5: 136,565,397 A5T probably benign Het
Dnajc13 G A 9: 104,190,391 P1190S probably benign Het
Fbxw7 T A 3: 84,974,552 V526E Het
Fig4 C A 10: 41,263,101 G369C probably damaging Het
Gabra1 C T 11: 42,135,488 A326T probably damaging Het
Gbe1 G A 16: 70,488,076 G429S probably benign Het
Gm340 T A 19: 41,582,904 S179T probably damaging Het
Gtf3c5 A T 2: 28,570,494 H364Q probably benign Het
Hcfc2 T A 10: 82,738,367 I125N probably damaging Het
Hnrnpul1 A T 7: 25,754,477 D53E probably benign Het
Il18 A T 9: 50,581,518 D128V possibly damaging Het
Intu T A 3: 40,653,772 S71R probably damaging Het
Klhl6 T C 16: 19,957,190 E206G possibly damaging Het
Mdga2 T C 12: 67,221,029 Y5C unknown Het
Naip1 C A 13: 100,429,213 V354L probably benign Het
Naip5 A G 13: 100,221,659 V1023A probably benign Het
Ndufaf1 A G 2: 119,660,087 L166P probably damaging Het
Ninl A T 2: 150,959,907 L147H probably damaging Het
Olfr1259 A G 2: 89,943,680 V145A possibly damaging Het
Olfr64 A G 7: 103,893,429 I102T probably damaging Het
Otogl C T 10: 107,853,266 probably null Het
Otulin AT ATT 15: 27,606,318 probably null Het
Phf11b A C 14: 59,338,697 L30R probably damaging Het
Prdm13 G T 4: 21,679,327 H388N unknown Het
Pwwp2b T C 7: 139,255,183 V180A probably damaging Het
Reep4 T A 14: 70,546,511 S23T probably damaging Het
Rusc2 T A 4: 43,425,378 L1161Q probably damaging Het
Scgb1b3 G A 7: 31,375,979 probably null Het
Scn10a G T 9: 119,670,389 N279K probably benign Het
Smurf2 A G 11: 106,824,752 L643S probably damaging Het
Sox12 G A 2: 152,397,272 P143S unknown Het
Specc1 C T 11: 62,118,675 T339I possibly damaging Het
Tas2r139 T C 6: 42,141,786 V284A probably benign Het
Thumpd3 T A 6: 113,063,146 C330* probably null Het
Ttc26 T A 6: 38,405,945 H338Q probably damaging Het
Ttn A G 2: 76,706,954 S34877P possibly damaging Het
Zfp568 T C 7: 29,998,204 S104P possibly damaging Het
Zfp933 G A 4: 147,828,453 H50Y possibly damaging Het
Other mutations in Ddx60
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Ddx60 APN 8 61958646 missense probably damaging 1.00
IGL00915:Ddx60 APN 8 61987431 missense possibly damaging 0.79
IGL00931:Ddx60 APN 8 61969583 missense probably benign 0.18
IGL01023:Ddx60 APN 8 61942514 missense probably damaging 0.99
IGL01313:Ddx60 APN 8 61982526 missense probably damaging 1.00
IGL01615:Ddx60 APN 8 61963740 missense probably null 0.81
IGL01733:Ddx60 APN 8 61983865 missense probably damaging 0.99
IGL01779:Ddx60 APN 8 62017823 missense possibly damaging 0.94
IGL01900:Ddx60 APN 8 62000709 splice site probably benign
IGL02110:Ddx60 APN 8 62017247 critical splice donor site probably null
IGL02302:Ddx60 APN 8 61975832 missense possibly damaging 0.85
IGL02468:Ddx60 APN 8 61958642 missense probably damaging 1.00
IGL02569:Ddx60 APN 8 62024951 missense possibly damaging 0.93
IGL02622:Ddx60 APN 8 61942436 splice site probably null
IGL02657:Ddx60 APN 8 61984115 missense probably benign 0.01
IGL02677:Ddx60 APN 8 61988132 missense probably damaging 1.00
IGL02701:Ddx60 APN 8 61979341 missense probably damaging 0.96
IGL02806:Ddx60 APN 8 61956122 missense probably benign 0.00
IGL03137:Ddx60 APN 8 61988083 missense possibly damaging 0.61
IGL03295:Ddx60 APN 8 61956121 missense possibly damaging 0.82
IGL03387:Ddx60 APN 8 62012449 missense probably damaging 1.00
IGL03411:Ddx60 APN 8 61977882 critical splice acceptor site probably null
PIT4504001:Ddx60 UTSW 8 61958113 missense probably benign
PIT4677001:Ddx60 UTSW 8 61972254 missense possibly damaging 0.87
R0090:Ddx60 UTSW 8 61942293 missense probably damaging 1.00
R0266:Ddx60 UTSW 8 62033493 missense possibly damaging 0.92
R0325:Ddx60 UTSW 8 61983855 missense probably benign 0.00
R0367:Ddx60 UTSW 8 62017749 missense possibly damaging 0.78
R0403:Ddx60 UTSW 8 61994541 splice site probably benign
R0479:Ddx60 UTSW 8 61969657 missense probably damaging 1.00
R0561:Ddx60 UTSW 8 62017794 missense possibly damaging 0.93
R0844:Ddx60 UTSW 8 61987361 missense probably benign 0.27
R1119:Ddx60 UTSW 8 61942544 missense probably damaging 1.00
R1428:Ddx60 UTSW 8 61958159 splice site probably benign
R1778:Ddx60 UTSW 8 61974176 missense possibly damaging 0.85
R1840:Ddx60 UTSW 8 61969553 missense probably damaging 0.99
R1964:Ddx60 UTSW 8 61948869 missense probably benign 0.10
R1970:Ddx60 UTSW 8 61972206 missense possibly damaging 0.93
R2101:Ddx60 UTSW 8 61940645 missense probably damaging 1.00
R2174:Ddx60 UTSW 8 61956141 missense probably damaging 1.00
R2174:Ddx60 UTSW 8 62017200 missense probably benign 0.01
R2198:Ddx60 UTSW 8 61958063 missense possibly damaging 0.79
R2332:Ddx60 UTSW 8 62037091 missense probably benign 0.08
R2338:Ddx60 UTSW 8 62012436 missense possibly damaging 0.91
R2379:Ddx60 UTSW 8 62037088 missense probably damaging 1.00
R4010:Ddx60 UTSW 8 61954535 missense possibly damaging 0.65
R4010:Ddx60 UTSW 8 61956144 missense probably benign 0.25
R4133:Ddx60 UTSW 8 61972220 missense probably damaging 0.99
R4282:Ddx60 UTSW 8 61994393 missense probably damaging 0.99
R4382:Ddx60 UTSW 8 61948978 splice site probably null
R4561:Ddx60 UTSW 8 61942461 missense probably damaging 0.96
R4572:Ddx60 UTSW 8 61987421 missense probably damaging 1.00
R4581:Ddx60 UTSW 8 62023261 missense possibly damaging 0.90
R4635:Ddx60 UTSW 8 62037067 missense probably benign 0.28
R4698:Ddx60 UTSW 8 62012424 missense probably benign 0.01
R4807:Ddx60 UTSW 8 61979338 missense probably damaging 1.00
R4858:Ddx60 UTSW 8 62021314 missense possibly damaging 0.80
R4964:Ddx60 UTSW 8 61979338 missense probably damaging 1.00
R5120:Ddx60 UTSW 8 61945906 missense probably benign 0.01
R5187:Ddx60 UTSW 8 61974188 missense probably damaging 1.00
R5222:Ddx60 UTSW 8 61984158 missense probably damaging 0.99
R5400:Ddx60 UTSW 8 62010002 missense possibly damaging 0.65
R5500:Ddx60 UTSW 8 61950451 missense probably benign 0.28
R5514:Ddx60 UTSW 8 61958057 missense probably damaging 1.00
R5668:Ddx60 UTSW 8 62000578 missense probably benign 0.38
R5742:Ddx60 UTSW 8 61948921 missense probably benign
R5772:Ddx60 UTSW 8 61948897 missense probably damaging 1.00
R5810:Ddx60 UTSW 8 62012388 nonsense probably null
R5815:Ddx60 UTSW 8 61963722 missense probably damaging 0.98
R5820:Ddx60 UTSW 8 61956121 missense possibly damaging 0.82
R5866:Ddx60 UTSW 8 61940740 missense probably damaging 1.00
R5881:Ddx60 UTSW 8 62037070 missense probably damaging 1.00
R5977:Ddx60 UTSW 8 62021410 critical splice donor site probably null
R6048:Ddx60 UTSW 8 62000582 missense probably benign 0.01
R6061:Ddx60 UTSW 8 62023241 missense probably null 0.01
R6153:Ddx60 UTSW 8 61945940 missense possibly damaging 0.47
R6287:Ddx60 UTSW 8 61950578 missense probably damaging 1.00
R6415:Ddx60 UTSW 8 61983905 missense probably benign 0.00
R6416:Ddx60 UTSW 8 61977950 missense probably benign 0.00
R6416:Ddx60 UTSW 8 61998681 missense probably benign
R6660:Ddx60 UTSW 8 61956239 missense probably benign 0.00
R6694:Ddx60 UTSW 8 62037070 missense probably damaging 1.00
R6715:Ddx60 UTSW 8 61983890 missense probably benign 0.03
R6720:Ddx60 UTSW 8 62000689 missense probably benign 0.10
R6937:Ddx60 UTSW 8 62037069 missense probably damaging 1.00
R7153:Ddx60 UTSW 8 61988108 missense possibly damaging 0.71
R7274:Ddx60 UTSW 8 61940108 critical splice donor site probably null
R7409:Ddx60 UTSW 8 61958578 missense probably benign 0.24
R7464:Ddx60 UTSW 8 61940674 missense possibly damaging 0.82
R7670:Ddx60 UTSW 8 61975792 missense probably damaging 1.00
R7904:Ddx60 UTSW 8 61977890 missense possibly damaging 0.81
R7992:Ddx60 UTSW 8 61954535 missense probably benign 0.03
R8124:Ddx60 UTSW 8 61983911 missense probably benign
R8125:Ddx60 UTSW 8 61983911 missense probably benign
R8126:Ddx60 UTSW 8 61983911 missense probably benign
R8155:Ddx60 UTSW 8 62017171 missense possibly damaging 0.61
R8174:Ddx60 UTSW 8 62017250 splice site probably null
R8192:Ddx60 UTSW 8 61977968 missense probably damaging 1.00
R8271:Ddx60 UTSW 8 61940108 critical splice donor site probably null
R8301:Ddx60 UTSW 8 62000597 missense probably benign 0.01
R8304:Ddx60 UTSW 8 61998769 missense possibly damaging 0.67
R8374:Ddx60 UTSW 8 61974171 missense probably benign 0.01
R8401:Ddx60 UTSW 8 61956243 missense possibly damaging 0.57
X0003:Ddx60 UTSW 8 62033417 missense possibly damaging 0.88
X0019:Ddx60 UTSW 8 61963692 missense probably benign 0.01
Z1177:Ddx60 UTSW 8 62000588 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- ATGAAGGCCTGAACGACCTG -3'
(R):5'- ACAGGGTGTTATTGCTTCTCATAACG -3'

Sequencing Primer
(F):5'- GAACGACCTGCAGACACATCTTTTC -3'
(R):5'- TGTGCATGTATATACAGAGGCC -3'
Posted On2020-07-28