Incidental Mutation 'R8319:Il18'
ID641862
Institutional Source Beutler Lab
Gene Symbol Il18
Ensembl Gene ENSMUSG00000039217
Gene Nameinterleukin 18
SynonymsIl-18, Igif
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8319 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location50554827-50581840 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 50581518 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 128 (D128V)
Ref Sequence ENSEMBL: ENSMUSP00000137193 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059081] [ENSMUST00000180021]
Predicted Effect possibly damaging
Transcript: ENSMUST00000059081
AA Change: D128V

PolyPhen 2 Score 0.646 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000054591
Gene: ENSMUSG00000039217
AA Change: D128V

DomainStartEndE-ValueType
IL1 49 187 7.09e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000180021
AA Change: D128V

PolyPhen 2 Score 0.732 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000137193
Gene: ENSMUSG00000039217
AA Change: D128V

DomainStartEndE-ValueType
IL1 49 187 7.09e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a proinflammatory cytokine that augments natural killer cell activity in spleen cells, and stimulates interferon gamma production in T-helper type I cells. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for null alleles are deficient in producing IFN-gamma in response to infectious agents and have other impairments of the immune system. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik A T 13: 59,690,672 D115E probably benign Het
Abcc1 T A 16: 14,396,451 L197Q probably damaging Het
Adamts14 T G 10: 61,221,927 N547T probably benign Het
Ampd3 T A 7: 110,795,775 S301R probably benign Het
Atg9a G A 1: 75,185,698 Q523* probably null Het
Atl1 A T 12: 69,955,319 T351S probably damaging Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Cacna1c T C 6: 118,637,774 I1315V Het
Ccdc109b A G 3: 129,933,679 F93L probably damaging Het
Col12a1 C T 9: 79,648,697 G2013R probably damaging Het
Cpne2 A G 8: 94,553,412 D153G probably benign Het
Cryzl1 T C 16: 91,692,363 S205G probably benign Het
Cux1 C T 5: 136,565,397 A5T probably benign Het
Ddx60 T C 8: 61,942,635 probably null Het
Dnajc13 G A 9: 104,190,391 P1190S probably benign Het
Fbxw7 T A 3: 84,974,552 V526E Het
Fig4 C A 10: 41,263,101 G369C probably damaging Het
Gabra1 C T 11: 42,135,488 A326T probably damaging Het
Gbe1 G A 16: 70,488,076 G429S probably benign Het
Gm340 T A 19: 41,582,904 S179T probably damaging Het
Gtf3c5 A T 2: 28,570,494 H364Q probably benign Het
Hcfc2 T A 10: 82,738,367 I125N probably damaging Het
Hnrnpul1 A T 7: 25,754,477 D53E probably benign Het
Intu T A 3: 40,653,772 S71R probably damaging Het
Klhl6 T C 16: 19,957,190 E206G possibly damaging Het
Mdga2 T C 12: 67,221,029 Y5C unknown Het
Naip1 C A 13: 100,429,213 V354L probably benign Het
Naip5 A G 13: 100,221,659 V1023A probably benign Het
Ndufaf1 A G 2: 119,660,087 L166P probably damaging Het
Ninl A T 2: 150,959,907 L147H probably damaging Het
Olfr1259 A G 2: 89,943,680 V145A possibly damaging Het
Olfr64 A G 7: 103,893,429 I102T probably damaging Het
Otogl C T 10: 107,853,266 probably null Het
Otulin AT ATT 15: 27,606,318 probably null Het
Phf11b A C 14: 59,338,697 L30R probably damaging Het
Prdm13 G T 4: 21,679,327 H388N unknown Het
Pwwp2b T C 7: 139,255,183 V180A probably damaging Het
Reep4 T A 14: 70,546,511 S23T probably damaging Het
Rusc2 T A 4: 43,425,378 L1161Q probably damaging Het
Scgb1b3 G A 7: 31,375,979 probably null Het
Scn10a G T 9: 119,670,389 N279K probably benign Het
Smurf2 A G 11: 106,824,752 L643S probably damaging Het
Sox12 G A 2: 152,397,272 P143S unknown Het
Specc1 C T 11: 62,118,675 T339I possibly damaging Het
Tas2r139 T C 6: 42,141,786 V284A probably benign Het
Thumpd3 T A 6: 113,063,146 C330* probably null Het
Ttc26 T A 6: 38,405,945 H338Q probably damaging Het
Ttn A G 2: 76,706,954 S34877P possibly damaging Het
Zfp568 T C 7: 29,998,204 S104P possibly damaging Het
Zfp933 G A 4: 147,828,453 H50Y possibly damaging Het
Other mutations in Il18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01095:Il18 APN 9 50579329 missense probably damaging 1.00
IGL02258:Il18 APN 9 50576703 missense probably benign 0.00
R0091:Il18 UTSW 9 50576713 splice site probably benign
R0355:Il18 UTSW 9 50579275 splice site probably benign
R0504:Il18 UTSW 9 50575328 missense probably damaging 0.99
R2295:Il18 UTSW 9 50579335 missense probably benign 0.33
R4162:Il18 UTSW 9 50579412 missense probably damaging 1.00
R5117:Il18 UTSW 9 50581509 missense possibly damaging 0.72
R5160:Il18 UTSW 9 50577893 critical splice donor site probably null
R7361:Il18 UTSW 9 50579314 missense probably damaging 1.00
R7462:Il18 UTSW 9 50565373 unclassified probably benign
R7522:Il18 UTSW 9 50575340 missense probably damaging 1.00
R7654:Il18 UTSW 9 50579401 missense possibly damaging 0.86
R8220:Il18 UTSW 9 50575316 missense possibly damaging 0.54
Predicted Primers PCR Primer
(F):5'- CTGCTTTAGGTCTGTTTAGCAATAGAC -3'
(R):5'- CTCCCCACCTAACTTTGATGTAAG -3'

Sequencing Primer
(F):5'- GGAAGAATTGGATCTCCTGGTAC -3'
(R):5'- TTTGATGTAAGTTAGTGAGAGTGAAC -3'
Posted On2020-07-28