Incidental Mutation 'R8319:Smurf2'
ID641872
Institutional Source Beutler Lab
Gene Symbol Smurf2
Ensembl Gene ENSMUSG00000018363
Gene NameSMAD specific E3 ubiquitin protein ligase 2
Synonyms2810411E22Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8319 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location106820066-106920715 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 106824752 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Serine at position 643 (L643S)
Ref Sequence ENSEMBL: ENSMUSP00000090177 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092517] [ENSMUST00000103067] [ENSMUST00000124898] [ENSMUST00000167787]
Predicted Effect probably damaging
Transcript: ENSMUST00000092517
AA Change: L643S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000090177
Gene: ENSMUSG00000018363
AA Change: L643S

DomainStartEndE-ValueType
C2 13 116 1.51e-15 SMART
WW 158 190 1.96e-11 SMART
WW 252 284 2.47e-8 SMART
WW 298 330 4.97e-13 SMART
low complexity region 341 351 N/A INTRINSIC
HECTc 412 748 1.75e-165 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000103067
AA Change: L630S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099356
Gene: ENSMUSG00000018363
AA Change: L630S

DomainStartEndE-ValueType
C2 13 103 1e-6 SMART
WW 145 177 1.96e-11 SMART
WW 239 271 2.47e-8 SMART
WW 285 317 4.97e-13 SMART
low complexity region 328 338 N/A INTRINSIC
HECTc 399 735 1.75e-165 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124898
SMART Domains Protein: ENSMUSP00000122454
Gene: ENSMUSG00000018372

DomainStartEndE-ValueType
coiled coil region 7 87 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000167787
AA Change: L643S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129269
Gene: ENSMUSG00000018363
AA Change: L643S

DomainStartEndE-ValueType
C2 13 116 1.51e-15 SMART
WW 158 190 1.96e-11 SMART
WW 252 284 2.47e-8 SMART
WW 298 330 4.97e-13 SMART
low complexity region 341 351 N/A INTRINSIC
HECTc 412 748 1.75e-165 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele occasionally exhibit kinked or looped tails and abnormal vertebrae. Mice homozygous or heterozygous for a gene trap allele exhibit increased tumor incidence and delayed cellular senescence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik A T 13: 59,690,672 D115E probably benign Het
Abcc1 T A 16: 14,396,451 L197Q probably damaging Het
Adamts14 T G 10: 61,221,927 N547T probably benign Het
Ampd3 T A 7: 110,795,775 S301R probably benign Het
Atg9a G A 1: 75,185,698 Q523* probably null Het
Atl1 A T 12: 69,955,319 T351S probably damaging Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Cacna1c T C 6: 118,637,774 I1315V Het
Ccdc109b A G 3: 129,933,679 F93L probably damaging Het
Col12a1 C T 9: 79,648,697 G2013R probably damaging Het
Cpne2 A G 8: 94,553,412 D153G probably benign Het
Cryzl1 T C 16: 91,692,363 S205G probably benign Het
Cux1 C T 5: 136,565,397 A5T probably benign Het
Ddx60 T C 8: 61,942,635 probably null Het
Dnajc13 G A 9: 104,190,391 P1190S probably benign Het
Fbxw7 T A 3: 84,974,552 V526E Het
Fig4 C A 10: 41,263,101 G369C probably damaging Het
Gabra1 C T 11: 42,135,488 A326T probably damaging Het
Gbe1 G A 16: 70,488,076 G429S probably benign Het
Gm340 T A 19: 41,582,904 S179T probably damaging Het
Gtf3c5 A T 2: 28,570,494 H364Q probably benign Het
Hcfc2 T A 10: 82,738,367 I125N probably damaging Het
Hnrnpul1 A T 7: 25,754,477 D53E probably benign Het
Il18 A T 9: 50,581,518 D128V possibly damaging Het
Intu T A 3: 40,653,772 S71R probably damaging Het
Klhl6 T C 16: 19,957,190 E206G possibly damaging Het
Mdga2 T C 12: 67,221,029 Y5C unknown Het
Naip1 C A 13: 100,429,213 V354L probably benign Het
Naip5 A G 13: 100,221,659 V1023A probably benign Het
Ndufaf1 A G 2: 119,660,087 L166P probably damaging Het
Ninl A T 2: 150,959,907 L147H probably damaging Het
Olfr1259 A G 2: 89,943,680 V145A possibly damaging Het
Olfr64 A G 7: 103,893,429 I102T probably damaging Het
Otogl C T 10: 107,853,266 probably null Het
Otulin AT ATT 15: 27,606,318 probably null Het
Phf11b A C 14: 59,338,697 L30R probably damaging Het
Prdm13 G T 4: 21,679,327 H388N unknown Het
Pwwp2b T C 7: 139,255,183 V180A probably damaging Het
Reep4 T A 14: 70,546,511 S23T probably damaging Het
Rusc2 T A 4: 43,425,378 L1161Q probably damaging Het
Scgb1b3 G A 7: 31,375,979 probably null Het
Scn10a G T 9: 119,670,389 N279K probably benign Het
Sox12 G A 2: 152,397,272 P143S unknown Het
Specc1 C T 11: 62,118,675 T339I possibly damaging Het
Tas2r139 T C 6: 42,141,786 V284A probably benign Het
Thumpd3 T A 6: 113,063,146 C330* probably null Het
Ttc26 T A 6: 38,405,945 H338Q probably damaging Het
Ttn A G 2: 76,706,954 S34877P possibly damaging Het
Zfp568 T C 7: 29,998,204 S104P possibly damaging Het
Zfp933 G A 4: 147,828,453 H50Y possibly damaging Het
Other mutations in Smurf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00836:Smurf2 APN 11 106852636 missense probably benign 0.17
IGL00980:Smurf2 APN 11 106836095 missense probably damaging 1.00
IGL01346:Smurf2 APN 11 106830915 splice site probably benign
IGL02016:Smurf2 APN 11 106822678 missense probably damaging 1.00
IGL02937:Smurf2 APN 11 106846047 missense probably damaging 1.00
IGL03136:Smurf2 APN 11 106831048 missense probably benign 0.38
R0513:Smurf2 UTSW 11 106836105 missense probably benign 0.22
R1171:Smurf2 UTSW 11 106852618 missense possibly damaging 0.80
R1459:Smurf2 UTSW 11 106852507 missense possibly damaging 0.78
R1687:Smurf2 UTSW 11 106836070 splice site probably null
R1697:Smurf2 UTSW 11 106824688 missense possibly damaging 0.76
R1706:Smurf2 UTSW 11 106824747 missense probably damaging 1.00
R2064:Smurf2 UTSW 11 106871548 missense probably damaging 1.00
R2072:Smurf2 UTSW 11 106841769 missense probably benign 0.00
R2433:Smurf2 UTSW 11 106868664 missense probably benign 0.06
R5250:Smurf2 UTSW 11 106856179 critical splice donor site probably null
R5531:Smurf2 UTSW 11 106852563 missense possibly damaging 0.47
R5835:Smurf2 UTSW 11 106836148 missense probably damaging 1.00
R5966:Smurf2 UTSW 11 106875901 missense possibly damaging 0.78
R6093:Smurf2 UTSW 11 106868623 missense possibly damaging 0.75
R6230:Smurf2 UTSW 11 106868504 splice site probably null
R6373:Smurf2 UTSW 11 106833769 missense probably damaging 1.00
R7011:Smurf2 UTSW 11 106833784 missense probably benign 0.16
R7335:Smurf2 UTSW 11 106846085 missense possibly damaging 0.52
R7472:Smurf2 UTSW 11 106836095 missense probably damaging 1.00
R7851:Smurf2 UTSW 11 106830926 missense probably damaging 1.00
R8246:Smurf2 UTSW 11 106831044 missense probably benign 0.02
RF002:Smurf2 UTSW 11 106852587 missense probably benign 0.22
Z1176:Smurf2 UTSW 11 106871529 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTAGATGCCAGGTACCTGTG -3'
(R):5'- AGTTACAGTCTCTGCAGCAC -3'

Sequencing Primer
(F):5'- GTGTGCCCATCCCATGACAC -3'
(R):5'- CTGTTCTGAAAGCTTTCCAGG -3'
Posted On2020-07-28