Incidental Mutation 'R8319:Otulin'
ID641880
Institutional Source Beutler Lab
Gene Symbol Otulin
Ensembl Gene ENSMUSG00000046034
Gene NameOTU deubiquitinase with linear linkage specificity
Synonymsm3Sapc, m7-1Sapc, Fam105b, gumby
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8319 (G1)
Quality Score217.468
Status Not validated
Chromosome15
Chromosomal Location27542635-27630693 bp(-) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) AT to ATT at 27606318 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000057893 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059662]
Predicted Effect probably null
Transcript: ENSMUST00000059662
SMART Domains Protein: ENSMUSP00000057893
Gene: ENSMUSG00000046034

DomainStartEndE-ValueType
low complexity region 18 33 N/A INTRINSIC
low complexity region 61 70 N/A INTRINSIC
Pfam:Peptidase_C101 80 344 4.7e-129 PFAM
Pfam:Peptidase_C65 96 344 1.1e-7 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peptidase C65 family of ubiquitin isopeptidases. Members of this family remove ubiquitin from proteins. The encoded enzyme specifically recognizes and removes M1(Met1)-linked, or linear, ubiquitin chains from protein substrates. Linear ubiquitin chains are known to regulate the NF-kappa B signaling pathway in the context of immunity and inflammation. Mutations in this gene cause a potentially fatal autoinflammatory syndrome in human patients. [provided by RefSeq, Sep 2016]
PHENOTYPE: Embryos homozygous for an ENU-induced mutation exhibit micrognathia, microcephaly, paucity of blood, and abnormal facial and vestibulocochlear nerve morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik A T 13: 59,690,672 D115E probably benign Het
Abcc1 T A 16: 14,396,451 L197Q probably damaging Het
Adamts14 T G 10: 61,221,927 N547T probably benign Het
Ampd3 T A 7: 110,795,775 S301R probably benign Het
Atg9a G A 1: 75,185,698 Q523* probably null Het
Atl1 A T 12: 69,955,319 T351S probably damaging Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Cacna1c T C 6: 118,637,774 I1315V Het
Ccdc109b A G 3: 129,933,679 F93L probably damaging Het
Col12a1 C T 9: 79,648,697 G2013R probably damaging Het
Cpne2 A G 8: 94,553,412 D153G probably benign Het
Cryzl1 T C 16: 91,692,363 S205G probably benign Het
Cux1 C T 5: 136,565,397 A5T probably benign Het
Ddx60 T C 8: 61,942,635 probably null Het
Dnajc13 G A 9: 104,190,391 P1190S probably benign Het
Fbxw7 T A 3: 84,974,552 V526E Het
Fig4 C A 10: 41,263,101 G369C probably damaging Het
Gabra1 C T 11: 42,135,488 A326T probably damaging Het
Gbe1 G A 16: 70,488,076 G429S probably benign Het
Gm340 T A 19: 41,582,904 S179T probably damaging Het
Gtf3c5 A T 2: 28,570,494 H364Q probably benign Het
Hcfc2 T A 10: 82,738,367 I125N probably damaging Het
Hnrnpul1 A T 7: 25,754,477 D53E probably benign Het
Il18 A T 9: 50,581,518 D128V possibly damaging Het
Intu T A 3: 40,653,772 S71R probably damaging Het
Klhl6 T C 16: 19,957,190 E206G possibly damaging Het
Mdga2 T C 12: 67,221,029 Y5C unknown Het
Naip1 C A 13: 100,429,213 V354L probably benign Het
Naip5 A G 13: 100,221,659 V1023A probably benign Het
Ndufaf1 A G 2: 119,660,087 L166P probably damaging Het
Ninl A T 2: 150,959,907 L147H probably damaging Het
Olfr1259 A G 2: 89,943,680 V145A possibly damaging Het
Olfr64 A G 7: 103,893,429 I102T probably damaging Het
Otogl C T 10: 107,853,266 probably null Het
Phf11b A C 14: 59,338,697 L30R probably damaging Het
Prdm13 G T 4: 21,679,327 H388N unknown Het
Pwwp2b T C 7: 139,255,183 V180A probably damaging Het
Reep4 T A 14: 70,546,511 S23T probably damaging Het
Rusc2 T A 4: 43,425,378 L1161Q probably damaging Het
Scgb1b3 G A 7: 31,375,979 probably null Het
Scn10a G T 9: 119,670,389 N279K probably benign Het
Smurf2 A G 11: 106,824,752 L643S probably damaging Het
Sox12 G A 2: 152,397,272 P143S unknown Het
Specc1 C T 11: 62,118,675 T339I possibly damaging Het
Tas2r139 T C 6: 42,141,786 V284A probably benign Het
Thumpd3 T A 6: 113,063,146 C330* probably null Het
Ttc26 T A 6: 38,405,945 H338Q probably damaging Het
Ttn A G 2: 76,706,954 S34877P possibly damaging Het
Zfp568 T C 7: 29,998,204 S104P possibly damaging Het
Zfp933 G A 4: 147,828,453 H50Y possibly damaging Het
Other mutations in Otulin
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02121:Otulin APN 15 27608737 missense probably damaging 1.00
R0265:Otulin UTSW 15 27616424 missense probably damaging 1.00
R0363:Otulin UTSW 15 27606295 missense probably damaging 1.00
R0508:Otulin UTSW 15 27608858 missense possibly damaging 0.93
R2915:Otulin UTSW 15 27619630 splice site probably benign
R6077:Otulin UTSW 15 27611610 missense probably benign 0.00
R7099:Otulin UTSW 15 27608746 missense probably damaging 1.00
R7145:Otulin UTSW 15 27608770 missense probably damaging 1.00
R7904:Otulin UTSW 15 27630494 missense probably benign 0.37
R8111:Otulin UTSW 15 27606295 missense probably damaging 1.00
X0013:Otulin UTSW 15 27606434 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GTGAAGGCTTGGCTAATTAATTCTC -3'
(R):5'- TGGCTTCCCTCAGAACACTC -3'

Sequencing Primer
(F):5'- GCTAGTCTTCAGAACATAATGGTCC -3'
(R):5'- GGCTTCCCTCAGAACACTCATTTG -3'
Posted On2020-07-28