Mutagenetix > Incidental Mutations

Incidental Mutation 'R8319:Klhl6'

641882

Institutional Source

Beutler Lab

Gene Symbol

Klhl6

Ensembl Gene

ENSMUSG00000043008

Gene Name

kelch-like 6

Synonyms

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.078) question?

Stock #

R8319 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

19946496-19983037 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 19957190 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 206 (E206G)

Ref Sequence

ENSEMBL: ENSMUSP00000053023 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000058839] [ENSMUST00000166801]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000058839
AA Change: E206G

PolyPhen 2 Score 0.742 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000053023
Gene: ENSMUSG00000043008
AA Change: E206G

Domain	Start	End	E-Value	Type
BTB	70	167	1.43e-25	SMART
BACK	172	274	1.68e-35	SMART
Kelch	376	419	3.05e-1	SMART
Kelch	420	466	6.82e-11	SMART
Kelch	467	514	4.27e-3	SMART
Kelch	515	556	3.06e-4	SMART
Kelch	557	604	3.47e-3	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000166801

SMART Domains

Protein: ENSMUSP00000130755
Gene: ENSMUSG00000043008

Domain	Start	End	E-Value	Type
Pfam:BTB	60	98	1.2e-9	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kelch-like (KLHL) family of proteins, which is involved in B-lymphocyte antigen receptor signaling and germinal-center B-cell maturation. The encoded protein contains an N-terminal broad-complex, tramtrack and bric a brac (BTB) domain that facilitates protein binding and dimerization, a BTB and C-terminal kelch (BACK) domain, and six C-terminal kelch repeat domains. Naturally occurring mutations in this gene are associated with chronic lymphocytic leukemia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit spleen hypoplasia, defects in mature B-cell subsets with normal pro- and pre-B-cell development, severely impaired antigen-dependent germinal center formation, and reduced memory IgG response. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921517D22Rik	A	T	13: 59,690,672	D115E	probably benign	Het
Abcc1	T	A	16: 14,396,451	L197Q	probably damaging	Het
Adamts14	T	G	10: 61,221,927	N547T	probably benign	Het
Ampd3	T	A	7: 110,795,775	S301R	probably benign	Het
Atg9a	G	A	1: 75,185,698	Q523*	probably null	Het
Atl1	A	T	12: 69,955,319	T351S	probably damaging	Het
Bhlhe40	TG	TGG	6: 108,664,857		probably null	Het
Cacna1c	T	C	6: 118,637,774	I1315V		Het
Ccdc109b	A	G	3: 129,933,679	F93L	probably damaging	Het
Col12a1	C	T	9: 79,648,697	G2013R	probably damaging	Het
Cpne2	A	G	8: 94,553,412	D153G	probably benign	Het
Cryzl1	T	C	16: 91,692,363	S205G	probably benign	Het
Cux1	C	T	5: 136,565,397	A5T	probably benign	Het
Ddx60	T	C	8: 61,942,635		probably null	Het
Dnajc13	G	A	9: 104,190,391	P1190S	probably benign	Het
Fbxw7	T	A	3: 84,974,552	V526E		Het
Fig4	C	A	10: 41,263,101	G369C	probably damaging	Het
Gabra1	C	T	11: 42,135,488	A326T	probably damaging	Het
Gbe1	G	A	16: 70,488,076	G429S	probably benign	Het
Gm340	T	A	19: 41,582,904	S179T	probably damaging	Het
Gtf3c5	A	T	2: 28,570,494	H364Q	probably benign	Het
Hcfc2	T	A	10: 82,738,367	I125N	probably damaging	Het
Hnrnpul1	A	T	7: 25,754,477	D53E	probably benign	Het
Il18	A	T	9: 50,581,518	D128V	possibly damaging	Het
Intu	T	A	3: 40,653,772	S71R	probably damaging	Het
Mdga2	T	C	12: 67,221,029	Y5C	unknown	Het
Naip1	C	A	13: 100,429,213	V354L	probably benign	Het
Naip5	A	G	13: 100,221,659	V1023A	probably benign	Het
Ndufaf1	A	G	2: 119,660,087	L166P	probably damaging	Het
Ninl	A	T	2: 150,959,907	L147H	probably damaging	Het
Olfr1259	A	G	2: 89,943,680	V145A	possibly damaging	Het
Olfr64	A	G	7: 103,893,429	I102T	probably damaging	Het
Otogl	C	T	10: 107,853,266		probably null	Het
Otulin	AT	ATT	15: 27,606,318		probably null	Het
Phf11b	A	C	14: 59,338,697	L30R	probably damaging	Het
Prdm13	G	T	4: 21,679,327	H388N	unknown	Het
Pwwp2b	T	C	7: 139,255,183	V180A	probably damaging	Het
Reep4	T	A	14: 70,546,511	S23T	probably damaging	Het
Rusc2	T	A	4: 43,425,378	L1161Q	probably damaging	Het
Scgb1b3	G	A	7: 31,375,979		probably null	Het
Scn10a	G	T	9: 119,670,389	N279K	probably benign	Het
Smurf2	A	G	11: 106,824,752	L643S	probably damaging	Het
Sox12	G	A	2: 152,397,272	P143S	unknown	Het
Specc1	C	T	11: 62,118,675	T339I	possibly damaging	Het
Tas2r139	T	C	6: 42,141,786	V284A	probably benign	Het
Thumpd3	T	A	6: 113,063,146	C330*	probably null	Het
Ttc26	T	A	6: 38,405,945	H338Q	probably damaging	Het
Ttn	A	G	2: 76,706,954	S34877P	possibly damaging	Het
Zfp568	T	C	7: 29,998,204	S104P	possibly damaging	Het
Zfp933	G	A	4: 147,828,453	H50Y	possibly damaging	Het

Other mutations in Klhl6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00788:Klhl6	APN	16	19957062	missense	probably benign	0.00
IGL01465:Klhl6	APN	16	19982822	missense	probably damaging	0.98
IGL01831:Klhl6	APN	16	19953485	missense	probably damaging	1.00
IGL01971:Klhl6	APN	16	19949526	missense	probably damaging	0.99
IGL02532:Klhl6	APN	16	19957082	missense	possibly damaging	0.84
IGL03113:Klhl6	APN	16	19957251	missense	possibly damaging	0.68
IGL03290:Klhl6	APN	16	19947137	missense	probably benign	0.44
Ascension	UTSW	16	19947098	missense	probably damaging	1.00
besmirched	UTSW	16	19949447	splice site	probably null
blau	UTSW	16	19957005	missense	probably damaging	1.00
blossom	UTSW	16	19957139	missense	probably damaging	1.00
cerulean	UTSW	16	19957218	nonsense	probably null
heights	UTSW	16	19957028	missense	probably damaging	0.98
Lazuli	UTSW	16	19956966	frame shift	probably null
Parula	UTSW	16	19957043	missense	possibly damaging	0.56
torres_del_paine	UTSW	16	19948127	missense	probably damaging	1.00
turquoise	UTSW	16	19982796	missense	probably damaging	1.00
IGL03046:Klhl6	UTSW	16	19982889	missense	probably benign
R0265:Klhl6	UTSW	16	19948234	missense	probably benign	0.43
R0496:Klhl6	UTSW	16	19956966	frame shift	probably null
R0497:Klhl6	UTSW	16	19956966	frame shift	probably null
R0540:Klhl6	UTSW	16	19957014	missense	possibly damaging	0.95
R0541:Klhl6	UTSW	16	19949447	splice site	probably null
R0554:Klhl6	UTSW	16	19953593	missense	probably damaging	0.96
R0607:Klhl6	UTSW	16	19957014	missense	possibly damaging	0.95
R0636:Klhl6	UTSW	16	19948073	splice site	probably benign
R0670:Klhl6	UTSW	16	19949559	missense	possibly damaging	0.92
R1477:Klhl6	UTSW	16	19965977	missense	probably benign	0.00
R1510:Klhl6	UTSW	16	19947098	missense	probably damaging	1.00
R1547:Klhl6	UTSW	16	19966082	missense	probably benign
R1747:Klhl6	UTSW	16	19947028	missense	probably benign	0.40
R1871:Klhl6	UTSW	16	19957043	missense	possibly damaging	0.56
R1966:Klhl6	UTSW	16	19982822	missense	probably damaging	0.98
R2058:Klhl6	UTSW	16	19982931	missense	probably benign
R4466:Klhl6	UTSW	16	19957268	missense	probably damaging	0.99
R4645:Klhl6	UTSW	16	19947147	missense	probably damaging	1.00
R4690:Klhl6	UTSW	16	19957284	missense	probably benign	0.44
R4824:Klhl6	UTSW	16	19957028	missense	probably damaging	0.98
R4833:Klhl6	UTSW	16	19957139	missense	probably damaging	1.00
R4835:Klhl6	UTSW	16	19957033	missense	probably benign	0.07
R5001:Klhl6	UTSW	16	19946991	makesense	probably null
R5475:Klhl6	UTSW	16	19948127	missense	probably damaging	1.00
R5700:Klhl6	UTSW	16	19957218	nonsense	probably null
R5867:Klhl6	UTSW	16	19982820	missense	probably benign	0.37
R5910:Klhl6	UTSW	16	19957094	missense	probably benign	0.04
R6992:Klhl6	UTSW	16	19953587	missense	probably damaging	1.00
R7082:Klhl6	UTSW	16	19982883	missense	probably benign	0.00
R7262:Klhl6	UTSW	16	19982796	missense	probably damaging	1.00
R7314:Klhl6	UTSW	16	19957005	missense	probably damaging	1.00
R7464:Klhl6	UTSW	16	19957113	missense	possibly damaging	0.58
R7688:Klhl6	UTSW	16	19947131	missense	probably damaging	1.00
R7957:Klhl6	UTSW	16	19949451	missense	probably null	1.00
R8460:Klhl6	UTSW	16	19957031	missense	probably damaging	1.00
Z1176:Klhl6	UTSW	16	19953674	missense	probably damaging	1.00
Z1177:Klhl6	UTSW	16	19982961	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GTGGTAAACGCACATTCTCGAG -3'
(R):5'- TCTGAGTTTGGCTGGCACAC -3'

Sequencing Primer
(F):5'- CACATTCTCGAGGACACAAGGG -3'
(R):5'- GAGTTTGGCTGGCACACACAAC -3'

Posted On

2020-07-28