Incidental Mutation 'R8319:Gbe1'
ID641883
Institutional Source Beutler Lab
Gene Symbol Gbe1
Ensembl Gene ENSMUSG00000022707
Gene Nameglucan (1,4-alpha-), branching enzyme 1
Synonyms2310045H19Rik, D16Ertd536e, 2810426P10Rik
Accession Numbers

Ncbi RefSeq: NM_028803.3; MGI:1921435

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8319 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location70313949-70569716 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 70488076 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 429 (G429S)
Ref Sequence ENSEMBL: ENSMUSP00000127642 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023393] [ENSMUST00000163832] [ENSMUST00000170464] [ENSMUST00000171132]
Predicted Effect probably benign
Transcript: ENSMUST00000023393
AA Change: G429S

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000023393
Gene: ENSMUSG00000022707
AA Change: G429S

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
Pfam:CBM_48 75 161 9.4e-17 PFAM
Pfam:Alpha-amylase 218 336 1.1e-17 PFAM
Pfam:Alpha-amylase_C 603 698 1.3e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163832
AA Change: G429S

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000132603
Gene: ENSMUSG00000022707
AA Change: G429S

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
Pfam:CBM_48 75 161 6e-19 PFAM
Pfam:Alpha-amylase 220 337 5.9e-14 PFAM
Pfam:Alpha-amylase_C 603 698 2.2e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170464
AA Change: G429S

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000131320
Gene: ENSMUSG00000022707
AA Change: G429S

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
Pfam:CBM_48 75 161 9.4e-17 PFAM
Pfam:Alpha-amylase 218 336 1.1e-17 PFAM
Pfam:Alpha-amylase_C 603 698 1.3e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171132
AA Change: G429S

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000127642
Gene: ENSMUSG00000022707
AA Change: G429S

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
Pfam:CBM_48 75 161 1.8e-17 PFAM
Pfam:Alpha-amylase 218 338 2.7e-18 PFAM
Pfam:Alpha-amylase_C 603 650 4.1e-12 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype Strain: 4868492; 5293612
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a glycogen branching enzyme that catalyzes the transfer of alpha-1,4-linked glucosyl units from the outer end of a glycogen chain to an alpha-1,6 position on the same or a neighboring glycogen chain. Branching of the chains is essential to increase the solubility of the glycogen molecule and, consequently, in reducing the osmotic pressure within cells. Highest level of this enzyme are found in liver and muscle. Mutations in this gene are associated with glycogen storage disease IV (also known as Andersen's disease). [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit mid-to-late gestation lethality, decreased heart rate, glycogen storage defects, and ventricles that were small, hypertrabeculated, and noncompacted. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(3) Chemically induced(1)

Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik A T 13: 59,690,672 D115E probably benign Het
Abcc1 T A 16: 14,396,451 L197Q probably damaging Het
Adamts14 T G 10: 61,221,927 N547T probably benign Het
Ampd3 T A 7: 110,795,775 S301R probably benign Het
Atg9a G A 1: 75,185,698 Q523* probably null Het
Atl1 A T 12: 69,955,319 T351S probably damaging Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Cacna1c T C 6: 118,637,774 I1315V Het
Ccdc109b A G 3: 129,933,679 F93L probably damaging Het
Col12a1 C T 9: 79,648,697 G2013R probably damaging Het
Cpne2 A G 8: 94,553,412 D153G probably benign Het
Cryzl1 T C 16: 91,692,363 S205G probably benign Het
Cux1 C T 5: 136,565,397 A5T probably benign Het
Ddx60 T C 8: 61,942,635 probably null Het
Dnajc13 G A 9: 104,190,391 P1190S probably benign Het
Fbxw7 T A 3: 84,974,552 V526E Het
Fig4 C A 10: 41,263,101 G369C probably damaging Het
Gabra1 C T 11: 42,135,488 A326T probably damaging Het
Gm340 T A 19: 41,582,904 S179T probably damaging Het
Gtf3c5 A T 2: 28,570,494 H364Q probably benign Het
Hcfc2 T A 10: 82,738,367 I125N probably damaging Het
Hnrnpul1 A T 7: 25,754,477 D53E probably benign Het
Il18 A T 9: 50,581,518 D128V possibly damaging Het
Intu T A 3: 40,653,772 S71R probably damaging Het
Klhl6 T C 16: 19,957,190 E206G possibly damaging Het
Mdga2 T C 12: 67,221,029 Y5C unknown Het
Naip1 C A 13: 100,429,213 V354L probably benign Het
Naip5 A G 13: 100,221,659 V1023A probably benign Het
Ndufaf1 A G 2: 119,660,087 L166P probably damaging Het
Ninl A T 2: 150,959,907 L147H probably damaging Het
Olfr1259 A G 2: 89,943,680 V145A possibly damaging Het
Olfr64 A G 7: 103,893,429 I102T probably damaging Het
Otogl C T 10: 107,853,266 probably null Het
Otulin AT ATT 15: 27,606,318 probably null Het
Phf11b A C 14: 59,338,697 L30R probably damaging Het
Prdm13 G T 4: 21,679,327 H388N unknown Het
Pwwp2b T C 7: 139,255,183 V180A probably damaging Het
Reep4 T A 14: 70,546,511 S23T probably damaging Het
Rusc2 T A 4: 43,425,378 L1161Q probably damaging Het
Scgb1b3 G A 7: 31,375,979 probably null Het
Scn10a G T 9: 119,670,389 N279K probably benign Het
Smurf2 A G 11: 106,824,752 L643S probably damaging Het
Sox12 G A 2: 152,397,272 P143S unknown Het
Specc1 C T 11: 62,118,675 T339I possibly damaging Het
Tas2r139 T C 6: 42,141,786 V284A probably benign Het
Thumpd3 T A 6: 113,063,146 C330* probably null Het
Ttc26 T A 6: 38,405,945 H338Q probably damaging Het
Ttn A G 2: 76,706,954 S34877P possibly damaging Het
Zfp568 T C 7: 29,998,204 S104P possibly damaging Het
Zfp933 G A 4: 147,828,453 H50Y possibly damaging Het
Other mutations in Gbe1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01783:Gbe1 APN 16 70478369 missense probably damaging 1.00
IGL01783:Gbe1 APN 16 70401855 critical splice donor site probably null
IGL02437:Gbe1 APN 16 70434658 splice site probably benign
IGL02635:Gbe1 APN 16 70569014 missense probably damaging 1.00
IGL02836:Gbe1 APN 16 70561095 missense possibly damaging 0.90
IGL03331:Gbe1 APN 16 70433578 missense probably damaging 1.00
IGL03138:Gbe1 UTSW 16 70529063 utr 3 prime probably benign
PIT4515001:Gbe1 UTSW 16 70441116 nonsense probably null
R0044:Gbe1 UTSW 16 70561132 nonsense probably null
R0044:Gbe1 UTSW 16 70561132 nonsense probably null
R0131:Gbe1 UTSW 16 70360852 splice site probably benign
R0178:Gbe1 UTSW 16 70478386 missense probably damaging 1.00
R0374:Gbe1 UTSW 16 70483914 missense probably benign 0.09
R1036:Gbe1 UTSW 16 70528887 missense probably damaging 1.00
R1162:Gbe1 UTSW 16 70381850 intron probably benign
R1759:Gbe1 UTSW 16 70488041 missense probably benign 0.11
R1780:Gbe1 UTSW 16 70495324 nonsense probably null
R1998:Gbe1 UTSW 16 70569041 missense probably damaging 1.00
R2001:Gbe1 UTSW 16 70528926 missense probably damaging 1.00
R2002:Gbe1 UTSW 16 70528926 missense probably damaging 1.00
R2269:Gbe1 UTSW 16 70436952 missense probably damaging 1.00
R2353:Gbe1 UTSW 16 70437021 splice site probably null
R2434:Gbe1 UTSW 16 70441212 missense probably damaging 1.00
R4114:Gbe1 UTSW 16 70483827 missense possibly damaging 0.64
R4528:Gbe1 UTSW 16 70478337 missense probably benign
R4736:Gbe1 UTSW 16 70495253 missense probably damaging 1.00
R4859:Gbe1 UTSW 16 70478401 missense probably damaging 1.00
R5884:Gbe1 UTSW 16 70528875 splice site probably null
R6222:Gbe1 UTSW 16 70529012 critical splice donor site probably null
R6527:Gbe1 UTSW 16 70433672 critical splice donor site probably null
R6770:Gbe1 UTSW 16 70314265 missense possibly damaging 0.86
R6770:Gbe1 UTSW 16 70401838 missense probably damaging 1.00
R6941:Gbe1 UTSW 16 70433556 small deletion probably benign
R7193:Gbe1 UTSW 16 70495370 missense probably damaging 1.00
R7232:Gbe1 UTSW 16 70436940 missense possibly damaging 0.91
R7343:Gbe1 UTSW 16 70361015 missense probably benign 0.09
R7810:Gbe1 UTSW 16 70527197 missense possibly damaging 0.92
R7822:Gbe1 UTSW 16 70433612 missense probably damaging 0.98
R7876:Gbe1 UTSW 16 70441171 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGGGATGTTGTACTAGAGTGTAAAC -3'
(R):5'- GCCTGAATAATAGACATGTGAAAGC -3'

Sequencing Primer
(F):5'- GATGTGAATTTACCACTCTATCGC -3'
(R):5'- ACTTCTTCAAAGTTTTGAGAACCACC -3'
Posted On2020-07-28