Incidental Mutation 'R8319:Cryzl1'
ID641884
Institutional Source Beutler Lab
Gene Symbol Cryzl1
Ensembl Gene ENSMUSG00000058240
Gene Namecrystallin, zeta (quinone reductase)-like 1
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R8319 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location91689322-91728975 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 91692363 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 205 (S205G)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023682] [ENSMUST00000073466] [ENSMUST00000114023] [ENSMUST00000114031] [ENSMUST00000117159] [ENSMUST00000117644] [ENSMUST00000122254] [ENSMUST00000124282] [ENSMUST00000136699] [ENSMUST00000138560] [ENSMUST00000139324] [ENSMUST00000144461] [ENSMUST00000145833] [ENSMUST00000159295]
Predicted Effect probably benign
Transcript: ENSMUST00000023682
SMART Domains Protein: ENSMUSP00000023682
Gene: ENSMUSG00000022960

DomainStartEndE-ValueType
low complexity region 34 55 N/A INTRINSIC
low complexity region 58 72 N/A INTRINSIC
low complexity region 340 361 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000073466
SMART Domains Protein: ENSMUSP00000073171
Gene: ENSMUSG00000058240

DomainStartEndE-ValueType
Pfam:ADH_N 30 142 3.7e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114023
SMART Domains Protein: ENSMUSP00000109656
Gene: ENSMUSG00000058240

DomainStartEndE-ValueType
Pfam:ADH_N 30 140 2e-8 PFAM
Pfam:ADH_zinc_N 156 231 5.8e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114031
SMART Domains Protein: ENSMUSP00000109665
Gene: ENSMUSG00000022960

DomainStartEndE-ValueType
low complexity region 34 55 N/A INTRINSIC
low complexity region 58 72 N/A INTRINSIC
low complexity region 340 361 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117159
SMART Domains Protein: ENSMUSP00000113220
Gene: ENSMUSG00000022960

DomainStartEndE-ValueType
low complexity region 34 55 N/A INTRINSIC
low complexity region 58 72 N/A INTRINSIC
low complexity region 340 361 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117644
SMART Domains Protein: ENSMUSP00000113227
Gene: ENSMUSG00000058240

DomainStartEndE-ValueType
Pfam:ADH_zinc_N 141 212 1.3e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000122254
SMART Domains Protein: ENSMUSP00000112734
Gene: ENSMUSG00000058240

DomainStartEndE-ValueType
Blast:PKS_ER 71 150 1e-9 BLAST
SCOP:d1heta1 73 137 4e-12 SMART
low complexity region 172 190 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124282
SMART Domains Protein: ENSMUSP00000115686
Gene: ENSMUSG00000058240

DomainStartEndE-ValueType
Pfam:ADH_N 30 150 1.7e-8 PFAM
Pfam:ADH_zinc_N 156 227 3.9e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136699
Predicted Effect probably benign
Transcript: ENSMUST00000138560
SMART Domains Protein: ENSMUSP00000121591
Gene: ENSMUSG00000022960

DomainStartEndE-ValueType
low complexity region 31 52 N/A INTRINSIC
low complexity region 55 69 N/A INTRINSIC
low complexity region 310 331 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139324
SMART Domains Protein: ENSMUSP00000120957
Gene: ENSMUSG00000022960

DomainStartEndE-ValueType
low complexity region 34 55 N/A INTRINSIC
low complexity region 58 72 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144461
SMART Domains Protein: ENSMUSP00000123648
Gene: ENSMUSG00000022960

DomainStartEndE-ValueType
low complexity region 34 55 N/A INTRINSIC
low complexity region 58 72 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144472
AA Change: S205G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000116833
Gene: ENSMUSG00000058240
AA Change: S205G

DomainStartEndE-ValueType
Blast:PKS_ER 2 152 8e-13 BLAST
PDB:3SLK|B 2 152 3e-10 PDB
SCOP:d1heta1 24 103 1e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000145833
Predicted Effect probably benign
Transcript: ENSMUST00000159295
SMART Domains Protein: ENSMUSP00000125172
Gene: ENSMUSG00000116933

DomainStartEndE-ValueType
Pfam:OSCP 1 89 1.1e-16 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that has sequence similarity to zeta crystallin, also known as quinone oxidoreductase. This zeta crystallin-like protein also contains an NAD(P)H binding site. Alternatively spliced transcript variants have been observed but their full-length nature has not been completely determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik A T 13: 59,690,672 D115E probably benign Het
Abcc1 T A 16: 14,396,451 L197Q probably damaging Het
Adamts14 T G 10: 61,221,927 N547T probably benign Het
Ampd3 T A 7: 110,795,775 S301R probably benign Het
Atg9a G A 1: 75,185,698 Q523* probably null Het
Atl1 A T 12: 69,955,319 T351S probably damaging Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Cacna1c T C 6: 118,637,774 I1315V Het
Ccdc109b A G 3: 129,933,679 F93L probably damaging Het
Col12a1 C T 9: 79,648,697 G2013R probably damaging Het
Cpne2 A G 8: 94,553,412 D153G probably benign Het
Cux1 C T 5: 136,565,397 A5T probably benign Het
Ddx60 T C 8: 61,942,635 probably null Het
Dnajc13 G A 9: 104,190,391 P1190S probably benign Het
Fbxw7 T A 3: 84,974,552 V526E Het
Fig4 C A 10: 41,263,101 G369C probably damaging Het
Gabra1 C T 11: 42,135,488 A326T probably damaging Het
Gbe1 G A 16: 70,488,076 G429S probably benign Het
Gm340 T A 19: 41,582,904 S179T probably damaging Het
Gtf3c5 A T 2: 28,570,494 H364Q probably benign Het
Hcfc2 T A 10: 82,738,367 I125N probably damaging Het
Hnrnpul1 A T 7: 25,754,477 D53E probably benign Het
Il18 A T 9: 50,581,518 D128V possibly damaging Het
Intu T A 3: 40,653,772 S71R probably damaging Het
Klhl6 T C 16: 19,957,190 E206G possibly damaging Het
Mdga2 T C 12: 67,221,029 Y5C unknown Het
Naip1 C A 13: 100,429,213 V354L probably benign Het
Naip5 A G 13: 100,221,659 V1023A probably benign Het
Ndufaf1 A G 2: 119,660,087 L166P probably damaging Het
Ninl A T 2: 150,959,907 L147H probably damaging Het
Olfr1259 A G 2: 89,943,680 V145A possibly damaging Het
Olfr64 A G 7: 103,893,429 I102T probably damaging Het
Otogl C T 10: 107,853,266 probably null Het
Otulin AT ATT 15: 27,606,318 probably null Het
Phf11b A C 14: 59,338,697 L30R probably damaging Het
Prdm13 G T 4: 21,679,327 H388N unknown Het
Pwwp2b T C 7: 139,255,183 V180A probably damaging Het
Reep4 T A 14: 70,546,511 S23T probably damaging Het
Rusc2 T A 4: 43,425,378 L1161Q probably damaging Het
Scgb1b3 G A 7: 31,375,979 probably null Het
Scn10a G T 9: 119,670,389 N279K probably benign Het
Smurf2 A G 11: 106,824,752 L643S probably damaging Het
Sox12 G A 2: 152,397,272 P143S unknown Het
Specc1 C T 11: 62,118,675 T339I possibly damaging Het
Tas2r139 T C 6: 42,141,786 V284A probably benign Het
Thumpd3 T A 6: 113,063,146 C330* probably null Het
Ttc26 T A 6: 38,405,945 H338Q probably damaging Het
Ttn A G 2: 76,706,954 S34877P possibly damaging Het
Zfp568 T C 7: 29,998,204 S104P possibly damaging Het
Zfp933 G A 4: 147,828,453 H50Y possibly damaging Het
Other mutations in Cryzl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02139:Cryzl1 APN 16 91712251 missense possibly damaging 0.90
IGL02937:Cryzl1 APN 16 91690731 missense possibly damaging 0.62
R0360:Cryzl1 UTSW 16 91707267 missense probably benign 0.00
R0364:Cryzl1 UTSW 16 91707267 missense probably benign 0.00
R0513:Cryzl1 UTSW 16 91699287 missense possibly damaging 0.87
R0630:Cryzl1 UTSW 16 91707219 splice site probably benign
R1355:Cryzl1 UTSW 16 91692658 missense possibly damaging 0.48
R1370:Cryzl1 UTSW 16 91692658 missense possibly damaging 0.48
R1709:Cryzl1 UTSW 16 91712236 missense probably damaging 0.99
R2284:Cryzl1 UTSW 16 91694305 unclassified probably benign
R5321:Cryzl1 UTSW 16 91707230 missense probably benign 0.01
R5768:Cryzl1 UTSW 16 91695354 missense probably damaging 1.00
R6468:Cryzl1 UTSW 16 91692525 splice site probably null
R7372:Cryzl1 UTSW 16 91712197 missense probably benign 0.24
Predicted Primers PCR Primer
(F):5'- GCATTTAGGAATATTTTATGCAGTGGC -3'
(R):5'- GAATTTGTCAAATGCACAACAGG -3'

Sequencing Primer
(F):5'- CAGTGGCACCATCATAAAAGTTAAG -3'
(R):5'- GCTAGCTTTGAATTGCCTTGTAC -3'
Posted On2020-07-28