Mutagenetix > Incidental Mutation

Incidental Mutation 'R8320:Cntnap5a'

641886

Institutional Source

Beutler Lab

Gene Symbol

Cntnap5a

Ensembl Gene

ENSMUSG00000070695

Gene Name

contactin associated protein-like 5A

Synonyms

Caspr5-1

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8320 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

115684756-116587323 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 116446736 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 993 (F993L)

Ref Sequence

ENSEMBL: ENSMUSP00000035732 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043725]

AlphaFold

Q0V8T9

Predicted Effect

possibly damaging
Transcript: ENSMUST00000043725
AA Change: F993L

PolyPhen 2 Score 0.624 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000035732
Gene: ENSMUSG00000070695
AA Change: F993L

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
FA58C	33	174	1.63e-13	SMART
LamG	201	338	1.4e-26	SMART
LamG	388	522	1.5e-26	SMART
EGF	550	584	2.16e-1	SMART
Blast:FBG	587	772	2e-81	BLAST
LamG	812	939	1.54e-28	SMART
EGF	960	996	2.28e0	SMART
LamG	1037	1173	4.73e-15	SMART
transmembrane domain	1241	1263	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product belongs to the neurexin family, members of which function in the vertebrate nervous system as cell adhesion molecules and receptors. This protein, like other neurexin proteins, contains epidermal growth factor repeats and laminin G domains. In addition, it includes an F5/8 type C domain, discoidin/neuropilin- and fibrinogen-like domains, and thrombospondin N-terminal-like domains. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Asb10	A	G	5: 24,537,628		probably null	Het
Bhlhe40	TG	TGG	6: 108,664,857	254	probably null	Het
Clec3a	T	C	8: 114,425,629	V125A	probably benign	Het
Clspn	A	G	4: 126,563,950	D258G	possibly damaging	Het
Cnn3	T	G	3: 121,449,986	L32R	probably damaging	Het
Cobl	A	G	11: 12,267,001	S496P	probably damaging	Het
Dmxl2	A	G	9: 54,383,759	V2469A	probably benign	Het
Dpcr1	T	C	17: 35,643,638	T11A	probably benign	Het
Egfr	T	C	11: 16,891,251	F714S	probably damaging	Het
Erap1	G	C	13: 74,666,549	E465Q	probably benign	Het
Ercc6	T	C	14: 32,521,015	V204A	probably benign	Het
Fbln2	C	T	6: 91,257,767	T689I	possibly damaging	Het
Fbxw13	G	T	9: 109,183,066	T311K	probably benign	Het
Foxj2	T	A	6: 122,833,690	S210T	probably benign	Het
Gnl1	A	G	17: 35,982,598	N225S	probably damaging	Het
Grid2	T	C	6: 63,256,933	I26T	probably benign	Het
Gzmd	A	G	14: 56,129,733	I234T	probably benign	Het
Igkv2-137	GA	GAA	6: 67,556,170		probably null	Het
Kif26b	T	C	1: 178,884,076		probably null	Het
Klk1b1	C	T	7: 43,970,343	R109C	possibly damaging	Het
Klra10	A	G	6: 130,269,248	C255R	probably damaging	Het
Lgi4	T	C	7: 31,068,941	V455A	probably benign	Het
Neb	C	A	2: 52,296,331	V910L	probably benign	Het
Pigg	G	A	5: 108,347,851	R918H	probably benign	Het
Poln	A	G	5: 34,149,827	V10A	possibly damaging	Het
Polr1a	T	A	6: 71,941,384	M642K	probably damaging	Het
Rasal1	C	T	5: 120,666,355	R431C	probably benign	Het
Rfc1	A	T	5: 65,303,036	Y167*	probably null	Het
Rnf17	TG	T	14: 56,424,542	132	probably null	Het
Sars2	C	T	7: 28,746,868	T174I	probably damaging	Het
Sept4	T	C	11: 87,589,734	V398A	possibly damaging	Het
Slc6a2	C	T	8: 92,992,848	T397I	probably benign	Het
Smarca4	G	T	9: 21,677,502	R1200L	probably benign	Het
Stx7	G	T	10: 24,179,148	A63S	probably damaging	Het
Sval3	G	A	6: 41,972,524	V99I	probably benign	Het
Syna	A	G	5: 134,559,720	I125T	possibly damaging	Het
Syne2	T	C	12: 76,103,830	S1827P	probably damaging	Het
Taf4b	T	C	18: 14,783,692	V33A	possibly damaging	Het
Tpcn2	C	T	7: 145,266,622	R373H	possibly damaging	Het
Trpm1	A	G	7: 64,268,793	D1511G	possibly damaging	Het
Ttc3	C	A	16: 94,418,676	R487S	probably damaging	Het
Tubb3	T	C	8: 123,420,855	S176P	possibly damaging	Het
Zfp189	C	G	4: 49,530,180	Q428E	probably benign	Het
Zscan4d	C	T	7: 11,066,015	V316M	probably benign	Het

Other mutations in Cntnap5a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00763:Cntnap5a	APN	1	116117677	missense	possibly damaging	0.48
IGL00929:Cntnap5a	APN	1	116060274	splice site	probably null
IGL00959:Cntnap5a	APN	1	116184327	missense	probably benign	0.00
IGL01721:Cntnap5a	APN	1	116157637	missense	probably benign
IGL02009:Cntnap5a	APN	1	116157494	missense	probably benign	0.15
IGL02111:Cntnap5a	APN	1	116089352	missense	probably benign	0.00
IGL02198:Cntnap5a	APN	1	116580532	missense	probably benign
IGL02751:Cntnap5a	APN	1	116184457	critical splice donor site	probably null
IGL02752:Cntnap5a	APN	1	116580531	missense	probably benign	0.00
IGL02989:Cntnap5a	APN	1	116412083	splice site	probably benign
IGL03195:Cntnap5a	APN	1	116157448	missense	probably benign	0.00
PIT4142001:Cntnap5a	UTSW	1	115684956	start gained	probably benign
R0294:Cntnap5a	UTSW	1	115915316	missense	probably benign
R0377:Cntnap5a	UTSW	1	116292529	missense	probably benign	0.04
R0597:Cntnap5a	UTSW	1	116184461	splice site	probably benign
R0616:Cntnap5a	UTSW	1	116580549	missense	possibly damaging	0.80
R0725:Cntnap5a	UTSW	1	116292476	missense	probably benign	0.25
R0842:Cntnap5a	UTSW	1	116442223	missense	probably damaging	0.96
R1103:Cntnap5a	UTSW	1	116580669	missense	possibly damaging	0.81
R1265:Cntnap5a	UTSW	1	116428518	missense	possibly damaging	0.49
R1467:Cntnap5a	UTSW	1	115685168	nonsense	probably null
R1467:Cntnap5a	UTSW	1	115685168	nonsense	probably null
R1470:Cntnap5a	UTSW	1	116259519	missense	probably damaging	1.00
R1470:Cntnap5a	UTSW	1	116259519	missense	probably damaging	1.00
R1474:Cntnap5a	UTSW	1	116442373	nonsense	probably null
R1476:Cntnap5a	UTSW	1	115901020	missense	probably damaging	1.00
R1481:Cntnap5a	UTSW	1	116117663	missense	probably damaging	1.00
R1512:Cntnap5a	UTSW	1	115900950	missense	probably benign
R1526:Cntnap5a	UTSW	1	116428477	missense	probably benign
R1589:Cntnap5a	UTSW	1	116060200	missense	possibly damaging	0.77
R1603:Cntnap5a	UTSW	1	116412101	missense	possibly damaging	0.80
R1728:Cntnap5a	UTSW	1	116455004	missense	probably benign	0.00
R1728:Cntnap5a	UTSW	1	116455101	missense	probably benign	0.00
R1728:Cntnap5a	UTSW	1	116455143	missense	probably benign	0.01
R1729:Cntnap5a	UTSW	1	116455004	missense	probably benign	0.00
R1729:Cntnap5a	UTSW	1	116455101	missense	probably benign	0.00
R1729:Cntnap5a	UTSW	1	116455143	missense	probably benign	0.01
R1730:Cntnap5a	UTSW	1	116455004	missense	probably benign	0.00
R1730:Cntnap5a	UTSW	1	116455101	missense	probably benign	0.00
R1730:Cntnap5a	UTSW	1	116455143	missense	probably benign	0.01
R1739:Cntnap5a	UTSW	1	116455004	missense	probably benign	0.00
R1739:Cntnap5a	UTSW	1	116455101	missense	probably benign	0.00
R1739:Cntnap5a	UTSW	1	116455143	missense	probably benign	0.01
R1762:Cntnap5a	UTSW	1	116455004	missense	probably benign	0.00
R1762:Cntnap5a	UTSW	1	116455101	missense	probably benign	0.00
R1762:Cntnap5a	UTSW	1	116455143	missense	probably benign	0.01
R1783:Cntnap5a	UTSW	1	116455004	missense	probably benign	0.00
R1783:Cntnap5a	UTSW	1	116455101	missense	probably benign	0.00
R1783:Cntnap5a	UTSW	1	116455143	missense	probably benign	0.01
R1785:Cntnap5a	UTSW	1	116455004	missense	probably benign	0.00
R1785:Cntnap5a	UTSW	1	116455101	missense	probably benign	0.00
R1785:Cntnap5a	UTSW	1	116455143	missense	probably benign	0.01
R1816:Cntnap5a	UTSW	1	116428888	missense	probably benign	0.19
R1872:Cntnap5a	UTSW	1	116089210	missense	probably benign	0.02
R2095:Cntnap5a	UTSW	1	116442260	missense	probably damaging	1.00
R2113:Cntnap5a	UTSW	1	116188365	missense	probably damaging	0.98
R2144:Cntnap5a	UTSW	1	116101710	missense	probably benign	0.14
R2171:Cntnap5a	UTSW	1	116188402	missense	possibly damaging	0.95
R2219:Cntnap5a	UTSW	1	116580639	missense	possibly damaging	0.83
R2220:Cntnap5a	UTSW	1	116580639	missense	possibly damaging	0.83
R2571:Cntnap5a	UTSW	1	116184362	missense	probably damaging	1.00
R3019:Cntnap5a	UTSW	1	116101569	missense	probably benign
R3827:Cntnap5a	UTSW	1	116117679	missense	probably benign	0.14
R3870:Cntnap5a	UTSW	1	116060249	missense	probably damaging	1.00
R3871:Cntnap5a	UTSW	1	116060249	missense	probably damaging	1.00
R4041:Cntnap5a	UTSW	1	116184399	missense	probably benign	0.00
R4080:Cntnap5a	UTSW	1	116101574	missense	probably benign	0.01
R4260:Cntnap5a	UTSW	1	116446595	missense	probably benign	0.31
R4685:Cntnap5a	UTSW	1	116446680	missense	possibly damaging	0.69
R4781:Cntnap5a	UTSW	1	116412201	missense	possibly damaging	0.88
R4785:Cntnap5a	UTSW	1	116101565	missense	probably benign	0.00
R5057:Cntnap5a	UTSW	1	115685213	missense	probably benign	0.10
R5059:Cntnap5a	UTSW	1	116428494	missense	probably benign	0.44
R5101:Cntnap5a	UTSW	1	116442296	missense	probably benign	0.00
R5302:Cntnap5a	UTSW	1	116157570	missense	probably benign	0.15
R5451:Cntnap5a	UTSW	1	115685143	missense	probably benign
R5473:Cntnap5a	UTSW	1	116089256	missense	probably benign	0.12
R5886:Cntnap5a	UTSW	1	116571672	critical splice donor site	probably null
R6311:Cntnap5a	UTSW	1	116412106	nonsense	probably null
R6464:Cntnap5a	UTSW	1	116184408	missense	probably benign
R6497:Cntnap5a	UTSW	1	116577897	missense	probably damaging	1.00
R6781:Cntnap5a	UTSW	1	116292397	missense	probably benign	0.05
R7137:Cntnap5a	UTSW	1	116089376	missense	probably damaging	1.00
R7290:Cntnap5a	UTSW	1	116221889	missense	probably damaging	1.00
R7342:Cntnap5a	UTSW	1	116060122	missense	probably benign	0.00
R7367:Cntnap5a	UTSW	1	116442295	missense	probably benign	0.00
R7373:Cntnap5a	UTSW	1	116580637	missense	probably benign	0.20
R7426:Cntnap5a	UTSW	1	116442380	missense	probably benign	0.03
R7444:Cntnap5a	UTSW	1	116292349	missense	probably benign
R7582:Cntnap5a	UTSW	1	116446632	missense	probably damaging	1.00
R7745:Cntnap5a	UTSW	1	116442283	missense	probably benign
R7948:Cntnap5a	UTSW	1	116580528	missense	probably benign	0.01
R7995:Cntnap5a	UTSW	1	116571547	missense	probably damaging	0.99
R8041:Cntnap5a	UTSW	1	116259479	missense	probably damaging	0.99
R8262:Cntnap5a	UTSW	1	116188410	missense	possibly damaging	0.66
R8273:Cntnap5a	UTSW	1	116571541	missense	probably damaging	1.00
R9242:Cntnap5a	UTSW	1	116292379	missense	probably benign	0.06
R9470:Cntnap5a	UTSW	1	116446614	missense	probably damaging	1.00
R9601:Cntnap5a	UTSW	1	116580487	missense	probably damaging	0.96
R9616:Cntnap5a	UTSW	1	116101593	missense	probably benign
R9623:Cntnap5a	UTSW	1	116442255	nonsense	probably null
Z1088:Cntnap5a	UTSW	1	116060251	missense	probably benign	0.08
Z1176:Cntnap5a	UTSW	1	116428516	missense	probably damaging	1.00
Z1177:Cntnap5a	UTSW	1	116412168	missense	probably benign	0.03
Z1188:Cntnap5a	UTSW	1	116518205	missense	possibly damaging	0.70

Predicted Primers

PCR Primer
(F):5'- CTCTTGAATGGGCATAAAGTAGACC -3'
(R):5'- GCATGGAAAAGGTTGGCTTG -3'

Sequencing Primer
(F):5'- TGGGCATAAAGTAGACCTGGAAG -3'
(R):5'- AGGTTGGCTTGACAATACCATG -3'

Posted On

2020-07-28