Incidental Mutation 'R8320:Cnn3'
ID641889
Institutional Source Beutler Lab
Gene Symbol Cnn3
Ensembl Gene ENSMUSG00000053931
Gene Namecalponin 3, acidic
SynonymsCalpo3, 1600014M03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.273) question?
Stock #R8320 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location121426497-121458207 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 121449986 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 32 (L32R)
Ref Sequence ENSEMBL: ENSMUSP00000029773 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029773] [ENSMUST00000197135] [ENSMUST00000198393]
Predicted Effect probably damaging
Transcript: ENSMUST00000029773
AA Change: L32R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029773
Gene: ENSMUSG00000053931
AA Change: L32R

DomainStartEndE-ValueType
CH 28 125 3.92e-27 SMART
Pfam:Calponin 164 188 1.1e-19 PFAM
Pfam:Calponin 204 228 7.4e-17 PFAM
Pfam:Calponin 243 267 1.8e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000197135
AA Change: L32R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142526
Gene: ENSMUSG00000053931
AA Change: L32R

DomainStartEndE-ValueType
CH 28 120 8.6e-10 SMART
Pfam:Calponin 158 183 1e-10 PFAM
Pfam:Calponin 197 222 9.6e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000198393
SMART Domains Protein: ENSMUSP00000143186
Gene: ENSMUSG00000053931

DomainStartEndE-ValueType
Blast:CH 1 28 7e-12 BLAST
SCOP:d1h67a_ 1 35 9e-9 SMART
PDB:1WYN|A 1 53 3e-21 PDB
Pfam:Calponin 67 92 1.2e-14 PFAM
Pfam:Calponin 107 132 3.8e-11 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with a markedly acidic C terminus; the basic N-terminus is highly homologous to the N-terminus of a related gene, CNN1. Members of the CNN gene family all contain similar tandemly repeated motifs. This encoded protein is associated with the cytoskeleton but is not involved in contraction. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit severe exencephaly, neuronal tissue overgrowth and die immediately postnatal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asb10 A G 5: 24,537,628 probably null Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Clec3a T C 8: 114,425,629 V125A probably benign Het
Clspn A G 4: 126,563,950 D258G possibly damaging Het
Cntnap5a T C 1: 116,446,736 F993L possibly damaging Het
Cobl A G 11: 12,267,001 S496P probably damaging Het
Dmxl2 A G 9: 54,383,759 V2469A probably benign Het
Dpcr1 T C 17: 35,643,638 T11A probably benign Het
Egfr T C 11: 16,891,251 F714S probably damaging Het
Erap1 G C 13: 74,666,549 E465Q probably benign Het
Ercc6 T C 14: 32,521,015 V204A probably benign Het
Fbln2 C T 6: 91,257,767 T689I possibly damaging Het
Fbxw13 G T 9: 109,183,066 T311K probably benign Het
Foxj2 T A 6: 122,833,690 S210T probably benign Het
Gnl1 A G 17: 35,982,598 N225S probably damaging Het
Grid2 T C 6: 63,256,933 I26T probably benign Het
Gzmd A G 14: 56,129,733 I234T probably benign Het
Igkv2-137 GA GAA 6: 67,556,170 probably null Het
Kif26b T C 1: 178,884,076 probably null Het
Klk1b1 C T 7: 43,970,343 R109C possibly damaging Het
Klra10 A G 6: 130,269,248 C255R probably damaging Het
Lgi4 T C 7: 31,068,941 V455A probably benign Het
Neb C A 2: 52,296,331 V910L probably benign Het
Pigg G A 5: 108,347,851 R918H probably benign Het
Poln A G 5: 34,149,827 V10A possibly damaging Het
Polr1a T A 6: 71,941,384 M642K probably damaging Het
Rasal1 C T 5: 120,666,355 R431C probably benign Het
Rfc1 A T 5: 65,303,036 Y167* probably null Het
Rnf17 TG T 14: 56,424,542 probably null Het
Sars2 C T 7: 28,746,868 T174I probably damaging Het
Sept4 T C 11: 87,589,734 V398A possibly damaging Het
Slc6a2 C T 8: 92,992,848 T397I probably benign Het
Smarca4 G T 9: 21,677,502 R1200L probably benign Het
Stx7 G T 10: 24,179,148 A63S probably damaging Het
Sval3 G A 6: 41,972,524 V99I probably benign Het
Syna A G 5: 134,559,720 I125T possibly damaging Het
Syne2 T C 12: 76,103,830 S1827P probably damaging Het
Taf4b T C 18: 14,783,692 V33A possibly damaging Het
Tpcn2 C T 7: 145,266,622 R373H possibly damaging Het
Trpm1 A G 7: 64,268,793 D1511G possibly damaging Het
Ttc3 C A 16: 94,418,676 R487S probably damaging Het
Tubb3 T C 8: 123,420,855 S176P possibly damaging Het
Zfp189 C G 4: 49,530,180 Q428E probably benign Het
Zscan4d C T 7: 11,066,015 V316M probably benign Het
Other mutations in Cnn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02900:Cnn3 APN 3 121451494 missense probably benign 0.03
BB009:Cnn3 UTSW 3 121451429 missense probably benign 0.15
BB019:Cnn3 UTSW 3 121451429 missense probably benign 0.15
R0711:Cnn3 UTSW 3 121449984 missense probably benign 0.00
R0811:Cnn3 UTSW 3 121454951 missense probably damaging 1.00
R0812:Cnn3 UTSW 3 121454951 missense probably damaging 1.00
R1368:Cnn3 UTSW 3 121457137 missense probably benign 0.01
R1567:Cnn3 UTSW 3 121449958 nonsense probably null
R1675:Cnn3 UTSW 3 121457169 nonsense probably null
R2132:Cnn3 UTSW 3 121451935 missense probably damaging 0.97
R2851:Cnn3 UTSW 3 121450053 start gained probably benign
R5850:Cnn3 UTSW 3 121451928 missense probably damaging 0.99
R6936:Cnn3 UTSW 3 121450053 start gained probably benign
R7196:Cnn3 UTSW 3 121454788 splice site probably null
R7851:Cnn3 UTSW 3 121457343 missense possibly damaging 0.85
R7866:Cnn3 UTSW 3 121451393 missense probably benign 0.16
R7867:Cnn3 UTSW 3 121455055 missense probably benign 0.27
R7932:Cnn3 UTSW 3 121451429 missense probably benign 0.15
R8139:Cnn3 UTSW 3 121455069 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCAACAGCTGGCTACAGTC -3'
(R):5'- TCAAGGTCAGCATTCTAAATGGG -3'

Sequencing Primer
(F):5'- AGCAAACTCTCCTGCGTG -3'
(R):5'- GTCAGCATTCTAAATGGGGAAAC -3'
Posted On2020-07-28