Incidental Mutation 'R8320:Zfp189'
ID641890
Institutional Source Beutler Lab
Gene Symbol Zfp189
Ensembl Gene ENSMUSG00000039634
Gene Namezinc finger protein 189
SynonymsC430015I23Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8320 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location49521176-49531517 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 49530180 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Glutamic Acid at position 428 (Q428E)
Ref Sequence ENSEMBL: ENSMUSP00000103324 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042964] [ENSMUST00000107696]
Predicted Effect probably benign
Transcript: ENSMUST00000042964
AA Change: Q428E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000036663
Gene: ENSMUSG00000039634
AA Change: Q428E

DomainStartEndE-ValueType
KRAB 11 61 1.98e-4 SMART
ZnF_C2H2 130 152 1.58e-3 SMART
ZnF_C2H2 158 180 1.47e-3 SMART
ZnF_C2H2 186 208 1.84e-4 SMART
ZnF_C2H2 214 236 2.43e-4 SMART
ZnF_C2H2 242 264 2.61e-4 SMART
ZnF_C2H2 270 292 2.75e-3 SMART
ZnF_C2H2 298 320 1.56e-2 SMART
ZnF_C2H2 326 348 7.26e-3 SMART
ZnF_C2H2 354 376 1.72e-4 SMART
ZnF_C2H2 382 404 3.21e-4 SMART
ZnF_C2H2 438 460 3.95e-4 SMART
ZnF_C2H2 466 488 1.12e-3 SMART
ZnF_C2H2 494 516 1.18e-2 SMART
ZnF_C2H2 522 544 4.24e-4 SMART
ZnF_C2H2 550 572 2.79e-4 SMART
ZnF_C2H2 581 603 2.05e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107696
AA Change: Q428E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000103324
Gene: ENSMUSG00000039634
AA Change: Q428E

DomainStartEndE-ValueType
KRAB 11 61 1.98e-4 SMART
ZnF_C2H2 130 152 1.58e-3 SMART
ZnF_C2H2 158 180 1.47e-3 SMART
ZnF_C2H2 186 208 1.84e-4 SMART
ZnF_C2H2 214 236 2.43e-4 SMART
ZnF_C2H2 242 264 2.61e-4 SMART
ZnF_C2H2 270 292 2.75e-3 SMART
ZnF_C2H2 298 320 1.56e-2 SMART
ZnF_C2H2 326 348 7.26e-3 SMART
ZnF_C2H2 354 376 1.72e-4 SMART
ZnF_C2H2 382 404 3.21e-4 SMART
ZnF_C2H2 438 460 3.95e-4 SMART
ZnF_C2H2 466 488 1.12e-3 SMART
ZnF_C2H2 494 516 1.18e-2 SMART
ZnF_C2H2 522 544 4.24e-4 SMART
ZnF_C2H2 550 572 2.79e-4 SMART
ZnF_C2H2 581 603 2.05e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Kruppel-like zinc finger proteins such as ZNF189 contain a conserved stretch of 7 amino acids that connects a variable number of DNA-binding zinc finger repeats of the cys(2)his(2) (C2H2) type (summarized by Odeberg et al., 1998 [PubMed 9653648]). Approximately 30% of human Kruppel-like zinc finger proteins contain an N-terminal Kruppel-associated box (KRAB) domain. The KRAB domain consists of approximately 75 amino acids that may be subdivided into an A box, which is present in every KRAB domain and is essential for transcriptional repression, and a B box, which is not always present.[supplied by OMIM, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asb10 A G 5: 24,537,628 probably null Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Clec3a T C 8: 114,425,629 V125A probably benign Het
Clspn A G 4: 126,563,950 D258G possibly damaging Het
Cnn3 T G 3: 121,449,986 L32R probably damaging Het
Cntnap5a T C 1: 116,446,736 F993L possibly damaging Het
Cobl A G 11: 12,267,001 S496P probably damaging Het
Dmxl2 A G 9: 54,383,759 V2469A probably benign Het
Dpcr1 T C 17: 35,643,638 T11A probably benign Het
Egfr T C 11: 16,891,251 F714S probably damaging Het
Erap1 G C 13: 74,666,549 E465Q probably benign Het
Ercc6 T C 14: 32,521,015 V204A probably benign Het
Fbln2 C T 6: 91,257,767 T689I possibly damaging Het
Fbxw13 G T 9: 109,183,066 T311K probably benign Het
Foxj2 T A 6: 122,833,690 S210T probably benign Het
Gnl1 A G 17: 35,982,598 N225S probably damaging Het
Grid2 T C 6: 63,256,933 I26T probably benign Het
Gzmd A G 14: 56,129,733 I234T probably benign Het
Igkv2-137 GA GAA 6: 67,556,170 probably null Het
Kif26b T C 1: 178,884,076 probably null Het
Klk1b1 C T 7: 43,970,343 R109C possibly damaging Het
Klra10 A G 6: 130,269,248 C255R probably damaging Het
Lgi4 T C 7: 31,068,941 V455A probably benign Het
Neb C A 2: 52,296,331 V910L probably benign Het
Pigg G A 5: 108,347,851 R918H probably benign Het
Poln A G 5: 34,149,827 V10A possibly damaging Het
Polr1a T A 6: 71,941,384 M642K probably damaging Het
Rasal1 C T 5: 120,666,355 R431C probably benign Het
Rfc1 A T 5: 65,303,036 Y167* probably null Het
Rnf17 TG T 14: 56,424,542 probably null Het
Sars2 C T 7: 28,746,868 T174I probably damaging Het
Sept4 T C 11: 87,589,734 V398A possibly damaging Het
Slc6a2 C T 8: 92,992,848 T397I probably benign Het
Smarca4 G T 9: 21,677,502 R1200L probably benign Het
Stx7 G T 10: 24,179,148 A63S probably damaging Het
Sval3 G A 6: 41,972,524 V99I probably benign Het
Syna A G 5: 134,559,720 I125T possibly damaging Het
Syne2 T C 12: 76,103,830 S1827P probably damaging Het
Taf4b T C 18: 14,783,692 V33A possibly damaging Het
Tpcn2 C T 7: 145,266,622 R373H possibly damaging Het
Trpm1 A G 7: 64,268,793 D1511G possibly damaging Het
Ttc3 C A 16: 94,418,676 R487S probably damaging Het
Tubb3 T C 8: 123,420,855 S176P possibly damaging Het
Zscan4d C T 7: 11,066,015 V316M probably benign Het
Other mutations in Zfp189
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02075:Zfp189 APN 4 49522445 missense probably damaging 0.98
R1754:Zfp189 UTSW 4 49529342 missense possibly damaging 0.87
R1848:Zfp189 UTSW 4 49529266 missense probably benign 0.01
R1868:Zfp189 UTSW 4 49529283 missense possibly damaging 0.90
R1903:Zfp189 UTSW 4 49529511 nonsense probably null
R2247:Zfp189 UTSW 4 49530393 missense possibly damaging 0.95
R2889:Zfp189 UTSW 4 49521547 start gained probably benign
R4389:Zfp189 UTSW 4 49529934 missense probably damaging 1.00
R4659:Zfp189 UTSW 4 49530342 missense probably benign 0.33
R4704:Zfp189 UTSW 4 49530081 missense probably damaging 0.98
R4840:Zfp189 UTSW 4 49529984 missense probably damaging 1.00
R4920:Zfp189 UTSW 4 49529302 missense probably damaging 0.98
R5011:Zfp189 UTSW 4 49530438 missense probably damaging 1.00
R5013:Zfp189 UTSW 4 49530438 missense probably damaging 1.00
R5522:Zfp189 UTSW 4 49529739 nonsense probably null
R5639:Zfp189 UTSW 4 49530153 missense probably benign 0.01
R6814:Zfp189 UTSW 4 49529026 missense probably damaging 0.99
R7372:Zfp189 UTSW 4 49530417 missense possibly damaging 0.95
R7491:Zfp189 UTSW 4 49521569 missense probably benign 0.06
R7680:Zfp189 UTSW 4 49521547 start gained probably benign
R7800:Zfp189 UTSW 4 49529367 missense possibly damaging 0.95
R8023:Zfp189 UTSW 4 49530312 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCAGTCGGAGCTCATTCCTTATTG -3'
(R):5'- CTGACAAGTAAAGGCTTCGC -3'

Sequencing Primer
(F):5'- CTTATCAGTGCCAAGAGTGCG -3'
(R):5'- GCTGCGCTGTTGACTAAAAC -3'
Posted On2020-07-28