Incidental Mutation 'R8320:Poln'
ID641893
Institutional Source Beutler Lab
Gene Symbol Poln
Ensembl Gene ENSMUSG00000045102
Gene NameDNA polymerase N
SynonymsPOL4P
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8320 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location34007179-34169448 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34149827 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 10 (V10A)
Ref Sequence ENSEMBL: ENSMUSP00000036110 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042954] [ENSMUST00000060049] [ENSMUST00000202409] [ENSMUST00000202638]
Predicted Effect possibly damaging
Transcript: ENSMUST00000042954
AA Change: V10A

PolyPhen 2 Score 0.702 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000036110
Gene: ENSMUSG00000045102
AA Change: V10A

DomainStartEndE-ValueType
low complexity region 110 121 N/A INTRINSIC
POLAc 605 814 7.88e-67 SMART
low complexity region 829 843 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000060049
SMART Domains Protein: ENSMUSP00000049973
Gene: ENSMUSG00000079555

DomainStartEndE-ValueType
Pfam:HAUS-augmin3 29 282 4.8e-85 PFAM
coiled coil region 294 336 N/A INTRINSIC
coiled coil region 459 495 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000202409
AA Change: V10A

PolyPhen 2 Score 0.702 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000144578
Gene: ENSMUSG00000045102
AA Change: V10A

DomainStartEndE-ValueType
low complexity region 110 121 N/A INTRINSIC
coiled coil region 448 471 N/A INTRINSIC
POLAc 587 796 2.6e-69 SMART
low complexity region 811 825 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202638
AA Change: V10A

PolyPhen 2 Score 0.137 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000143793
Gene: ENSMUSG00000045102
AA Change: V10A

DomainStartEndE-ValueType
low complexity region 110 121 N/A INTRINSIC
coiled coil region 448 471 N/A INTRINSIC
POLAc 605 770 3e-37 SMART
low complexity region 785 799 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced meiotic double-strand breaks at a meiotic recombination hot spot harboring insertion/deletion polymorphisms, but are otherwise normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asb10 A G 5: 24,537,628 probably null Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Clec3a T C 8: 114,425,629 V125A probably benign Het
Clspn A G 4: 126,563,950 D258G possibly damaging Het
Cnn3 T G 3: 121,449,986 L32R probably damaging Het
Cntnap5a T C 1: 116,446,736 F993L possibly damaging Het
Cobl A G 11: 12,267,001 S496P probably damaging Het
Dmxl2 A G 9: 54,383,759 V2469A probably benign Het
Dpcr1 T C 17: 35,643,638 T11A probably benign Het
Egfr T C 11: 16,891,251 F714S probably damaging Het
Erap1 G C 13: 74,666,549 E465Q probably benign Het
Ercc6 T C 14: 32,521,015 V204A probably benign Het
Fbln2 C T 6: 91,257,767 T689I possibly damaging Het
Fbxw13 G T 9: 109,183,066 T311K probably benign Het
Foxj2 T A 6: 122,833,690 S210T probably benign Het
Gnl1 A G 17: 35,982,598 N225S probably damaging Het
Grid2 T C 6: 63,256,933 I26T probably benign Het
Gzmd A G 14: 56,129,733 I234T probably benign Het
Igkv2-137 GA GAA 6: 67,556,170 probably null Het
Kif26b T C 1: 178,884,076 probably null Het
Klk1b1 C T 7: 43,970,343 R109C possibly damaging Het
Klra10 A G 6: 130,269,248 C255R probably damaging Het
Lgi4 T C 7: 31,068,941 V455A probably benign Het
Neb C A 2: 52,296,331 V910L probably benign Het
Pigg G A 5: 108,347,851 R918H probably benign Het
Polr1a T A 6: 71,941,384 M642K probably damaging Het
Rasal1 C T 5: 120,666,355 R431C probably benign Het
Rfc1 A T 5: 65,303,036 Y167* probably null Het
Rnf17 TG T 14: 56,424,542 probably null Het
Sars2 C T 7: 28,746,868 T174I probably damaging Het
Sept4 T C 11: 87,589,734 V398A possibly damaging Het
Slc6a2 C T 8: 92,992,848 T397I probably benign Het
Smarca4 G T 9: 21,677,502 R1200L probably benign Het
Stx7 G T 10: 24,179,148 A63S probably damaging Het
Sval3 G A 6: 41,972,524 V99I probably benign Het
Syna A G 5: 134,559,720 I125T possibly damaging Het
Syne2 T C 12: 76,103,830 S1827P probably damaging Het
Taf4b T C 18: 14,783,692 V33A possibly damaging Het
Tpcn2 C T 7: 145,266,622 R373H possibly damaging Het
Trpm1 A G 7: 64,268,793 D1511G possibly damaging Het
Ttc3 C A 16: 94,418,676 R487S probably damaging Het
Tubb3 T C 8: 123,420,855 S176P possibly damaging Het
Zfp189 C G 4: 49,530,180 Q428E probably benign Het
Zscan4d C T 7: 11,066,015 V316M probably benign Het
Other mutations in Poln
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00803:Poln APN 5 34122760 missense probably benign 0.17
IGL00938:Poln APN 5 34129224 missense probably damaging 1.00
IGL02081:Poln APN 5 34129139 missense probably benign
IGL02411:Poln APN 5 34113322 nonsense probably null
IGL02440:Poln APN 5 34129130 missense probably damaging 1.00
IGL02484:Poln APN 5 34129377 missense probably damaging 1.00
IGL02577:Poln APN 5 34113335 missense probably benign 0.03
IGL03113:Poln APN 5 34116862 missense probably benign 0.01
R0034:Poln UTSW 5 34115418 missense possibly damaging 0.78
R0034:Poln UTSW 5 34115418 missense possibly damaging 0.78
R0068:Poln UTSW 5 34077088 splice site probably benign
R0068:Poln UTSW 5 34077088 splice site probably benign
R0325:Poln UTSW 5 34149764 missense probably benign 0.00
R0578:Poln UTSW 5 34014338 missense probably damaging 1.00
R0631:Poln UTSW 5 34118958 missense possibly damaging 0.93
R1171:Poln UTSW 5 34103940 missense probably damaging 1.00
R1266:Poln UTSW 5 34133109 critical splice donor site probably null
R1418:Poln UTSW 5 34078975 missense probably benign 0.00
R1449:Poln UTSW 5 34014338 missense probably damaging 1.00
R1558:Poln UTSW 5 34032799 missense probably benign 0.04
R1723:Poln UTSW 5 34122672 missense probably benign 0.16
R1806:Poln UTSW 5 34107150 splice site probably benign
R4124:Poln UTSW 5 34103951 missense probably benign 0.32
R4125:Poln UTSW 5 34103951 missense probably benign 0.32
R4128:Poln UTSW 5 34103951 missense probably benign 0.32
R4155:Poln UTSW 5 34009649 missense possibly damaging 0.90
R4353:Poln UTSW 5 34129452 missense probably benign 0.00
R4717:Poln UTSW 5 34129448 missense possibly damaging 0.46
R4788:Poln UTSW 5 34129331 missense probably benign 0.30
R4981:Poln UTSW 5 34107085 critical splice donor site probably null
R5456:Poln UTSW 5 34007442 missense possibly damaging 0.95
R6020:Poln UTSW 5 34109431 missense probably damaging 0.99
R6484:Poln UTSW 5 34129513 missense probably benign 0.01
R7134:Poln UTSW 5 34118996 missense possibly damaging 0.86
R7639:Poln UTSW 5 34133151 missense possibly damaging 0.77
R7764:Poln UTSW 5 34116807 critical splice donor site probably null
R7874:Poln UTSW 5 34024350 missense probably damaging 1.00
R8039:Poln UTSW 5 34122672 missense probably benign 0.16
R8315:Poln UTSW 5 34109373 missense probably benign 0.00
R8340:Poln UTSW 5 34149774 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCAATTTGGTCACAATGAATGGG -3'
(R):5'- TTCAACTTGTATCAACATGTCTCAC -3'

Sequencing Primer
(F):5'- CCTTTTTAGGCAACAAAATTCCC -3'
(R):5'- CAGCCTGGTCTACAAAGTGAGTTAC -3'
Posted On2020-07-28