Incidental Mutation 'R8320:Rasal1'
ID641896
Institutional Source Beutler Lab
Gene Symbol Rasal1
Ensembl Gene ENSMUSG00000029602
Gene NameRAS protein activator like 1 (GAP1 like)
SynonymsMRASAL
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8320 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location120648812-120679597 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 120666355 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 431 (R431C)
Ref Sequence ENSEMBL: ENSMUSP00000031606 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031606] [ENSMUST00000156722]
Predicted Effect probably benign
Transcript: ENSMUST00000031606
AA Change: R431C

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000031606
Gene: ENSMUSG00000029602
AA Change: R431C

DomainStartEndE-ValueType
C2 6 113 7.74e-13 SMART
C2 134 231 2e-15 SMART
RasGAP 241 604 3.96e-166 SMART
PH 566 674 2.76e-16 SMART
BTK 674 710 2.24e-4 SMART
low complexity region 731 745 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156722
AA Change: R431C

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000123266
Gene: ENSMUSG00000029602
AA Change: R431C

DomainStartEndE-ValueType
C2 6 113 7.74e-13 SMART
C2 134 231 2e-15 SMART
RasGAP 241 604 3.96e-166 SMART
PH 566 674 2.76e-16 SMART
BTK 674 710 2.24e-4 SMART
low complexity region 731 745 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is member of the GAP1 family of GTPase-activating proteins. These proteins stimulate the GTPase activity of normal RAS p21 but not its oncogenic counterpart. Acting as a suppressor of RAS function, the protein enhances the weak intrinsic GTPase activity of RAS proteins resulting in the inactive GDP-bound form of RAS, thereby allowing control of cellular proliferation and differentiation. This particular family member contains domains which are characteristic of the GAP1 subfamily of RasGAP proteins but, in contrast to the other GAP1 family members, this protein is strongly and selectively expressed in endocrine tissues. Alternatively spliced transcript variants that encode different isoforms have been described [provided by RefSeq, Jul 2010]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asb10 A G 5: 24,537,628 probably null Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Clec3a T C 8: 114,425,629 V125A probably benign Het
Clspn A G 4: 126,563,950 D258G possibly damaging Het
Cnn3 T G 3: 121,449,986 L32R probably damaging Het
Cntnap5a T C 1: 116,446,736 F993L possibly damaging Het
Cobl A G 11: 12,267,001 S496P probably damaging Het
Dmxl2 A G 9: 54,383,759 V2469A probably benign Het
Dpcr1 T C 17: 35,643,638 T11A probably benign Het
Egfr T C 11: 16,891,251 F714S probably damaging Het
Erap1 G C 13: 74,666,549 E465Q probably benign Het
Ercc6 T C 14: 32,521,015 V204A probably benign Het
Fbln2 C T 6: 91,257,767 T689I possibly damaging Het
Fbxw13 G T 9: 109,183,066 T311K probably benign Het
Foxj2 T A 6: 122,833,690 S210T probably benign Het
Gnl1 A G 17: 35,982,598 N225S probably damaging Het
Grid2 T C 6: 63,256,933 I26T probably benign Het
Gzmd A G 14: 56,129,733 I234T probably benign Het
Igkv2-137 GA GAA 6: 67,556,170 probably null Het
Kif26b T C 1: 178,884,076 probably null Het
Klk1b1 C T 7: 43,970,343 R109C possibly damaging Het
Klra10 A G 6: 130,269,248 C255R probably damaging Het
Lgi4 T C 7: 31,068,941 V455A probably benign Het
Neb C A 2: 52,296,331 V910L probably benign Het
Pigg G A 5: 108,347,851 R918H probably benign Het
Poln A G 5: 34,149,827 V10A possibly damaging Het
Polr1a T A 6: 71,941,384 M642K probably damaging Het
Rfc1 A T 5: 65,303,036 Y167* probably null Het
Rnf17 TG T 14: 56,424,542 probably null Het
Sars2 C T 7: 28,746,868 T174I probably damaging Het
Sept4 T C 11: 87,589,734 V398A possibly damaging Het
Slc6a2 C T 8: 92,992,848 T397I probably benign Het
Smarca4 G T 9: 21,677,502 R1200L probably benign Het
Stx7 G T 10: 24,179,148 A63S probably damaging Het
Sval3 G A 6: 41,972,524 V99I probably benign Het
Syna A G 5: 134,559,720 I125T possibly damaging Het
Syne2 T C 12: 76,103,830 S1827P probably damaging Het
Taf4b T C 18: 14,783,692 V33A possibly damaging Het
Tpcn2 C T 7: 145,266,622 R373H possibly damaging Het
Trpm1 A G 7: 64,268,793 D1511G possibly damaging Het
Ttc3 C A 16: 94,418,676 R487S probably damaging Het
Tubb3 T C 8: 123,420,855 S176P possibly damaging Het
Zfp189 C G 4: 49,530,180 Q428E probably benign Het
Zscan4d C T 7: 11,066,015 V316M probably benign Het
Other mutations in Rasal1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00909:Rasal1 APN 5 120664807 missense probably damaging 1.00
IGL01700:Rasal1 APN 5 120676817 missense probably benign 0.06
IGL01790:Rasal1 APN 5 120670318 missense possibly damaging 0.61
IGL01866:Rasal1 APN 5 120675423 missense probably damaging 1.00
IGL02143:Rasal1 APN 5 120652852 missense probably damaging 1.00
IGL02527:Rasal1 APN 5 120666404 missense probably damaging 0.98
IGL02565:Rasal1 APN 5 120676780 splice site probably benign
IGL02710:Rasal1 APN 5 120666431 missense possibly damaging 0.71
PIT4618001:Rasal1 UTSW 5 120670376 missense probably damaging 0.99
R0270:Rasal1 UTSW 5 120674729 missense probably damaging 0.97
R0281:Rasal1 UTSW 5 120674605 missense probably benign
R0673:Rasal1 UTSW 5 120670384 missense probably benign 0.26
R1227:Rasal1 UTSW 5 120670307 missense probably damaging 0.99
R1475:Rasal1 UTSW 5 120662982 missense possibly damaging 0.55
R1486:Rasal1 UTSW 5 120654852 missense probably damaging 1.00
R1557:Rasal1 UTSW 5 120676849 missense possibly damaging 0.87
R1651:Rasal1 UTSW 5 120652845 nonsense probably null
R1792:Rasal1 UTSW 5 120664756 missense probably benign 0.06
R2148:Rasal1 UTSW 5 120662031 missense probably damaging 0.97
R2964:Rasal1 UTSW 5 120671620 missense probably damaging 0.99
R2966:Rasal1 UTSW 5 120671620 missense probably damaging 0.99
R2983:Rasal1 UTSW 5 120654862 missense probably benign 0.45
R4090:Rasal1 UTSW 5 120675609 missense possibly damaging 0.95
R4205:Rasal1 UTSW 5 120659563 missense probably benign 0.21
R4643:Rasal1 UTSW 5 120678964 missense probably benign 0.05
R4979:Rasal1 UTSW 5 120678676 missense probably benign
R5171:Rasal1 UTSW 5 120663764 missense probably benign
R5187:Rasal1 UTSW 5 120675395 missense probably benign 0.13
R5877:Rasal1 UTSW 5 120679070 utr 3 prime probably benign
R5924:Rasal1 UTSW 5 120675517 missense probably damaging 1.00
R6037:Rasal1 UTSW 5 120649501 missense possibly damaging 0.55
R6037:Rasal1 UTSW 5 120649501 missense possibly damaging 0.55
R6136:Rasal1 UTSW 5 120675478 missense possibly damaging 0.84
R6159:Rasal1 UTSW 5 120659608 missense probably damaging 1.00
R6292:Rasal1 UTSW 5 120659620 missense probably damaging 0.97
R6548:Rasal1 UTSW 5 120674725 missense probably benign 0.00
R7042:Rasal1 UTSW 5 120663960 splice site probably null
R7194:Rasal1 UTSW 5 120675492 missense probably benign
R7356:Rasal1 UTSW 5 120654825 missense possibly damaging 0.65
R7406:Rasal1 UTSW 5 120662937 missense probably benign 0.11
R7662:Rasal1 UTSW 5 120662184 missense probably benign 0.36
R8089:Rasal1 UTSW 5 120671578 missense probably damaging 1.00
R8321:Rasal1 UTSW 5 120666355 missense probably benign 0.01
R8362:Rasal1 UTSW 5 120675420 missense probably damaging 1.00
R8368:Rasal1 UTSW 5 120671550 missense probably damaging 1.00
R8379:Rasal1 UTSW 5 120666355 missense probably benign 0.01
R8380:Rasal1 UTSW 5 120666355 missense probably benign 0.01
R8383:Rasal1 UTSW 5 120666355 missense probably benign 0.01
R8710:Rasal1 UTSW 5 120662937 missense probably benign 0.11
R8817:Rasal1 UTSW 5 120670351 missense probably damaging 0.96
X0057:Rasal1 UTSW 5 120664512 critical splice donor site probably null
Z1176:Rasal1 UTSW 5 120652816 missense probably damaging 1.00
Z1176:Rasal1 UTSW 5 120664849 missense probably benign 0.00
Z1177:Rasal1 UTSW 5 120676838 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCTGGGTGTTCAAGCTCTG -3'
(R):5'- CAAGTCTGAGCATCCTAGGTCC -3'

Sequencing Primer
(F):5'- CTGGTGTCAGGGAAGGGC -3'
(R):5'- AGCATCCTAGGTCCTGGTGTC -3'
Posted On2020-07-28