Mutagenetix > Incidental Mutation

Incidental Mutation 'R8320:Rasal1'

641896

Institutional Source

Beutler Lab

Gene Symbol

Rasal1

Ensembl Gene

ENSMUSG00000029602

Gene Name

RAS protein activator like 1 (GAP1 like)

Synonyms

MRASAL

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8320 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

120648812-120679597 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 120666355 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Cysteine at position 431 (R431C)

Ref Sequence

ENSEMBL: ENSMUSP00000031606 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031606] [ENSMUST00000156722]

AlphaFold

Q9Z268

Predicted Effect

probably benign
Transcript: ENSMUST00000031606
AA Change: R431C

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)

SMART Domains

Protein: ENSMUSP00000031606
Gene: ENSMUSG00000029602
AA Change: R431C

Domain	Start	End	E-Value	Type
C2	6	113	7.74e-13	SMART
C2	134	231	2e-15	SMART
RasGAP	241	604	3.96e-166	SMART
PH	566	674	2.76e-16	SMART
BTK	674	710	2.24e-4	SMART
low complexity region	731	745	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000156722
AA Change: R431C

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)

SMART Domains

Protein: ENSMUSP00000123266
Gene: ENSMUSG00000029602
AA Change: R431C

Domain	Start	End	E-Value	Type
C2	6	113	7.74e-13	SMART
C2	134	231	2e-15	SMART
RasGAP	241	604	3.96e-166	SMART
PH	566	674	2.76e-16	SMART
BTK	674	710	2.24e-4	SMART
low complexity region	731	745	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is member of the GAP1 family of GTPase-activating proteins. These proteins stimulate the GTPase activity of normal RAS p21 but not its oncogenic counterpart. Acting as a suppressor of RAS function, the protein enhances the weak intrinsic GTPase activity of RAS proteins resulting in the inactive GDP-bound form of RAS, thereby allowing control of cellular proliferation and differentiation. This particular family member contains domains which are characteristic of the GAP1 subfamily of RasGAP proteins but, in contrast to the other GAP1 family members, this protein is strongly and selectively expressed in endocrine tissues. Alternatively spliced transcript variants that encode different isoforms have been described [provided by RefSeq, Jul 2010]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Asb10	A	G	5: 24,537,628		probably null	Het
Bhlhe40	TG	TGG	6: 108,664,857	254	probably null	Het
Clec3a	T	C	8: 114,425,629	V125A	probably benign	Het
Clspn	A	G	4: 126,563,950	D258G	possibly damaging	Het
Cnn3	T	G	3: 121,449,986	L32R	probably damaging	Het
Cntnap5a	T	C	1: 116,446,736	F993L	possibly damaging	Het
Cobl	A	G	11: 12,267,001	S496P	probably damaging	Het
Dmxl2	A	G	9: 54,383,759	V2469A	probably benign	Het
Dpcr1	T	C	17: 35,643,638	T11A	probably benign	Het
Egfr	T	C	11: 16,891,251	F714S	probably damaging	Het
Erap1	G	C	13: 74,666,549	E465Q	probably benign	Het
Ercc6	T	C	14: 32,521,015	V204A	probably benign	Het
Fbln2	C	T	6: 91,257,767	T689I	possibly damaging	Het
Fbxw13	G	T	9: 109,183,066	T311K	probably benign	Het
Foxj2	T	A	6: 122,833,690	S210T	probably benign	Het
Gnl1	A	G	17: 35,982,598	N225S	probably damaging	Het
Grid2	T	C	6: 63,256,933	I26T	probably benign	Het
Gzmd	A	G	14: 56,129,733	I234T	probably benign	Het
Igkv2-137	GA	GAA	6: 67,556,170		probably null	Het
Kif26b	T	C	1: 178,884,076		probably null	Het
Klk1b1	C	T	7: 43,970,343	R109C	possibly damaging	Het
Klra10	A	G	6: 130,269,248	C255R	probably damaging	Het
Lgi4	T	C	7: 31,068,941	V455A	probably benign	Het
Neb	C	A	2: 52,296,331	V910L	probably benign	Het
Pigg	G	A	5: 108,347,851	R918H	probably benign	Het
Poln	A	G	5: 34,149,827	V10A	possibly damaging	Het
Polr1a	T	A	6: 71,941,384	M642K	probably damaging	Het
Rfc1	A	T	5: 65,303,036	Y167*	probably null	Het
Rnf17	TG	T	14: 56,424,542	132	probably null	Het
Sars2	C	T	7: 28,746,868	T174I	probably damaging	Het
Sept4	T	C	11: 87,589,734	V398A	possibly damaging	Het
Slc6a2	C	T	8: 92,992,848	T397I	probably benign	Het
Smarca4	G	T	9: 21,677,502	R1200L	probably benign	Het
Stx7	G	T	10: 24,179,148	A63S	probably damaging	Het
Sval3	G	A	6: 41,972,524	V99I	probably benign	Het
Syna	A	G	5: 134,559,720	I125T	possibly damaging	Het
Syne2	T	C	12: 76,103,830	S1827P	probably damaging	Het
Taf4b	T	C	18: 14,783,692	V33A	possibly damaging	Het
Tpcn2	C	T	7: 145,266,622	R373H	possibly damaging	Het
Trpm1	A	G	7: 64,268,793	D1511G	possibly damaging	Het
Ttc3	C	A	16: 94,418,676	R487S	probably damaging	Het
Tubb3	T	C	8: 123,420,855	S176P	possibly damaging	Het
Zfp189	C	G	4: 49,530,180	Q428E	probably benign	Het
Zscan4d	C	T	7: 11,066,015	V316M	probably benign	Het

Other mutations in Rasal1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00909:Rasal1	APN	5	120664807	missense	probably damaging	1.00
IGL01700:Rasal1	APN	5	120676817	missense	probably benign	0.06
IGL01790:Rasal1	APN	5	120670318	missense	possibly damaging	0.61
IGL01866:Rasal1	APN	5	120675423	missense	probably damaging	1.00
IGL02143:Rasal1	APN	5	120652852	missense	probably damaging	1.00
IGL02527:Rasal1	APN	5	120666404	missense	probably damaging	0.98
IGL02565:Rasal1	APN	5	120676780	splice site	probably benign
IGL02710:Rasal1	APN	5	120666431	missense	possibly damaging	0.71
PIT4618001:Rasal1	UTSW	5	120670376	missense	probably damaging	0.99
R0270:Rasal1	UTSW	5	120674729	missense	probably damaging	0.97
R0281:Rasal1	UTSW	5	120674605	missense	probably benign
R0673:Rasal1	UTSW	5	120670384	missense	probably benign	0.26
R1227:Rasal1	UTSW	5	120670307	missense	probably damaging	0.99
R1475:Rasal1	UTSW	5	120662982	missense	possibly damaging	0.55
R1486:Rasal1	UTSW	5	120654852	missense	probably damaging	1.00
R1557:Rasal1	UTSW	5	120676849	missense	possibly damaging	0.87
R1651:Rasal1	UTSW	5	120652845	nonsense	probably null
R1792:Rasal1	UTSW	5	120664756	missense	probably benign	0.06
R2148:Rasal1	UTSW	5	120662031	missense	probably damaging	0.97
R2964:Rasal1	UTSW	5	120671620	missense	probably damaging	0.99
R2966:Rasal1	UTSW	5	120671620	missense	probably damaging	0.99
R2983:Rasal1	UTSW	5	120654862	missense	probably benign	0.45
R4090:Rasal1	UTSW	5	120675609	missense	possibly damaging	0.95
R4205:Rasal1	UTSW	5	120659563	missense	probably benign	0.21
R4643:Rasal1	UTSW	5	120678964	missense	probably benign	0.05
R4979:Rasal1	UTSW	5	120678676	missense	probably benign
R5171:Rasal1	UTSW	5	120663764	missense	probably benign
R5187:Rasal1	UTSW	5	120675395	missense	probably benign	0.13
R5877:Rasal1	UTSW	5	120679070	utr 3 prime	probably benign
R5924:Rasal1	UTSW	5	120675517	missense	probably damaging	1.00
R6037:Rasal1	UTSW	5	120649501	missense	possibly damaging	0.55
R6037:Rasal1	UTSW	5	120649501	missense	possibly damaging	0.55
R6136:Rasal1	UTSW	5	120675478	missense	possibly damaging	0.84
R6159:Rasal1	UTSW	5	120659608	missense	probably damaging	1.00
R6292:Rasal1	UTSW	5	120659620	missense	probably damaging	0.97
R6548:Rasal1	UTSW	5	120674725	missense	probably benign	0.00
R7042:Rasal1	UTSW	5	120663960	splice site	probably null
R7194:Rasal1	UTSW	5	120675492	missense	probably benign
R7356:Rasal1	UTSW	5	120654825	missense	possibly damaging	0.65
R7406:Rasal1	UTSW	5	120662937	missense	probably benign	0.11
R7662:Rasal1	UTSW	5	120662184	missense	probably benign	0.36
R8089:Rasal1	UTSW	5	120671578	missense	probably damaging	1.00
R8321:Rasal1	UTSW	5	120666355	missense	probably benign	0.01
R8362:Rasal1	UTSW	5	120675420	missense	probably damaging	1.00
R8368:Rasal1	UTSW	5	120671550	missense	probably damaging	1.00
R8379:Rasal1	UTSW	5	120666355	missense	probably benign	0.01
R8380:Rasal1	UTSW	5	120666355	missense	probably benign	0.01
R8383:Rasal1	UTSW	5	120666355	missense	probably benign	0.01
R8710:Rasal1	UTSW	5	120662937	missense	probably benign	0.11
R8817:Rasal1	UTSW	5	120670351	missense	probably damaging	0.96
R9258:Rasal1	UTSW	5	120655090	missense	possibly damaging	0.91
R9300:Rasal1	UTSW	5	120664107	missense	probably damaging	1.00
R9394:Rasal1	UTSW	5	120678681	missense	probably benign
R9746:Rasal1	UTSW	5	120662293	missense	probably damaging	1.00
X0057:Rasal1	UTSW	5	120664512	critical splice donor site	probably null
Z1176:Rasal1	UTSW	5	120652816	missense	probably damaging	1.00
Z1176:Rasal1	UTSW	5	120664849	missense	probably benign	0.00
Z1177:Rasal1	UTSW	5	120676838	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTCTGGGTGTTCAAGCTCTG -3'
(R):5'- CAAGTCTGAGCATCCTAGGTCC -3'

Sequencing Primer
(F):5'- CTGGTGTCAGGGAAGGGC -3'
(R):5'- AGCATCCTAGGTCCTGGTGTC -3'

Posted On

2020-07-28