Incidental Mutation 'R8320:Syna'
ID 641897
Institutional Source Beutler Lab
Gene Symbol Syna
Ensembl Gene ENSMUSG00000085957
Gene Name syncytin a
Synonyms syncytin-A, Gm52
MMRRC Submission 067722-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8320 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 134587000-134589025 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 134588574 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 125 (I125T)
Ref Sequence ENSEMBL: ENSMUSP00000116437 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000149604]
AlphaFold Q5G5D5
Predicted Effect possibly damaging
Transcript: ENSMUST00000149604
AA Change: I125T

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000116437
Gene: ENSMUSG00000085957
AA Change: I125T

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:TLV_coat 333 578 1.9e-59 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: Many different endogenous retrovirus families are expressed in normal placental tissue at high levels, suggesting that endogenous retroviruses are functionally important in reproduction. This gene is part of a mouse endogenous retrovirus provirus on chromosome 5 that has inactivating mutations in the gag and pol genes. This gene is the envelope glycoprotein gene which appears to have been selectively preserved. The gene's protein product plays a major role in placental development and trophoblast fusion. The protein has the characteristics of a typical retroviral envelope protein, including a cleavage site that separates the surface (SU) and transmembrane (TM) proteins which form a heterodimer. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit lethality between E11.5 and E14.5 associated with defective placental layrinth formation, impaired placental transport, and increased trophoblast cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asb10 A G 5: 24,742,626 (GRCm39) probably null Het
Bhlhe40 TG TGG 6: 108,641,818 (GRCm39) 254 probably null Het
Clec3a T C 8: 115,152,369 (GRCm39) V125A probably benign Het
Clspn A G 4: 126,457,743 (GRCm39) D258G possibly damaging Het
Cnn3 T G 3: 121,243,635 (GRCm39) L32R probably damaging Het
Cntnap5a T C 1: 116,374,466 (GRCm39) F993L possibly damaging Het
Cobl A G 11: 12,217,001 (GRCm39) S496P probably damaging Het
Dmxl2 A G 9: 54,291,043 (GRCm39) V2469A probably benign Het
Egfr T C 11: 16,841,251 (GRCm39) F714S probably damaging Het
Erap1 G C 13: 74,814,668 (GRCm39) E465Q probably benign Het
Ercc6 T C 14: 32,242,972 (GRCm39) V204A probably benign Het
Fbln2 C T 6: 91,234,749 (GRCm39) T689I possibly damaging Het
Fbxw13 G T 9: 109,012,134 (GRCm39) T311K probably benign Het
Foxj2 T A 6: 122,810,649 (GRCm39) S210T probably benign Het
Gnl1 A G 17: 36,293,490 (GRCm39) N225S probably damaging Het
Grid2 T C 6: 63,233,917 (GRCm39) I26T probably benign Het
Gzmd A G 14: 56,367,190 (GRCm39) I234T probably benign Het
Igkv2-137 GA GAA 6: 67,533,154 (GRCm39) probably null Het
Kif26b T C 1: 178,711,641 (GRCm39) probably null Het
Klk1b1 C T 7: 43,619,767 (GRCm39) R109C possibly damaging Het
Klra10 A G 6: 130,246,211 (GRCm39) C255R probably damaging Het
Lgi4 T C 7: 30,768,366 (GRCm39) V455A probably benign Het
Mucl3 T C 17: 35,954,530 (GRCm39) T11A probably benign Het
Neb C A 2: 52,186,343 (GRCm39) V910L probably benign Het
Pigg G A 5: 108,495,717 (GRCm39) R918H probably benign Het
Poln A G 5: 34,307,171 (GRCm39) V10A possibly damaging Het
Polr1a T A 6: 71,918,368 (GRCm39) M642K probably damaging Het
Rasal1 C T 5: 120,804,420 (GRCm39) R431C probably benign Het
Rfc1 A T 5: 65,460,379 (GRCm39) Y167* probably null Het
Rnf17 TG T 14: 56,661,999 (GRCm39) 132 probably null Het
Sars2 C T 7: 28,446,293 (GRCm39) T174I probably damaging Het
Septin4 T C 11: 87,480,560 (GRCm39) V398A possibly damaging Het
Slc6a2 C T 8: 93,719,476 (GRCm39) T397I probably benign Het
Smarca4 G T 9: 21,588,798 (GRCm39) R1200L probably benign Het
Stx7 G T 10: 24,055,046 (GRCm39) A63S probably damaging Het
Sval3 G A 6: 41,949,458 (GRCm39) V99I probably benign Het
Syne2 T C 12: 76,150,604 (GRCm39) S1827P probably damaging Het
Taf4b T C 18: 14,916,749 (GRCm39) V33A possibly damaging Het
Tpcn2 C T 7: 144,820,359 (GRCm39) R373H possibly damaging Het
Trpm1 A G 7: 63,918,541 (GRCm39) D1511G possibly damaging Het
Ttc3 C A 16: 94,219,535 (GRCm39) R487S probably damaging Het
Tubb3 T C 8: 124,147,594 (GRCm39) S176P possibly damaging Het
Zfp189 C G 4: 49,530,180 (GRCm39) Q428E probably benign Het
Zscan4d C T 7: 10,799,942 (GRCm39) V316M probably benign Het
Other mutations in Syna
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Syna APN 5 134,588,571 (GRCm39) missense possibly damaging 0.94
IGL01128:Syna APN 5 134,588,334 (GRCm39) missense probably damaging 0.99
IGL03183:Syna APN 5 134,587,144 (GRCm39) missense probably benign 0.03
R0051:Syna UTSW 5 134,588,397 (GRCm39) missense probably damaging 1.00
R0051:Syna UTSW 5 134,588,397 (GRCm39) missense probably damaging 0.99
R0137:Syna UTSW 5 134,588,314 (GRCm39) missense possibly damaging 0.93
R0920:Syna UTSW 5 134,587,956 (GRCm39) missense probably benign 0.12
R1525:Syna UTSW 5 134,588,112 (GRCm39) missense probably benign
R1801:Syna UTSW 5 134,588,943 (GRCm39) missense probably benign 0.02
R1813:Syna UTSW 5 134,588,006 (GRCm39) missense probably benign 0.06
R1866:Syna UTSW 5 134,588,769 (GRCm39) missense probably damaging 1.00
R1887:Syna UTSW 5 134,588,106 (GRCm39) missense probably benign
R1896:Syna UTSW 5 134,588,006 (GRCm39) missense probably benign 0.06
R2139:Syna UTSW 5 134,588,106 (GRCm39) nonsense probably null
R3896:Syna UTSW 5 134,587,165 (GRCm39) nonsense probably null
R4674:Syna UTSW 5 134,587,209 (GRCm39) missense probably damaging 0.99
R4730:Syna UTSW 5 134,587,440 (GRCm39) missense probably damaging 1.00
R5124:Syna UTSW 5 134,588,424 (GRCm39) missense possibly damaging 0.65
R5482:Syna UTSW 5 134,588,028 (GRCm39) missense possibly damaging 0.94
R6130:Syna UTSW 5 134,587,122 (GRCm39) missense possibly damaging 0.72
R6196:Syna UTSW 5 134,588,466 (GRCm39) missense probably benign 0.14
R6243:Syna UTSW 5 134,588,968 (GRCm39) start gained probably benign
R6945:Syna UTSW 5 134,587,815 (GRCm39) missense probably damaging 0.97
R7999:Syna UTSW 5 134,588,046 (GRCm39) missense probably benign
R8783:Syna UTSW 5 134,588,723 (GRCm39) missense probably benign 0.01
R8784:Syna UTSW 5 134,588,723 (GRCm39) missense probably benign 0.01
R8785:Syna UTSW 5 134,588,723 (GRCm39) missense probably benign 0.01
R8786:Syna UTSW 5 134,588,723 (GRCm39) missense probably benign 0.01
R8787:Syna UTSW 5 134,588,723 (GRCm39) missense probably benign 0.01
X0022:Syna UTSW 5 134,588,427 (GRCm39) missense probably benign 0.01
Z1088:Syna UTSW 5 134,587,383 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GAGCTGAAAGGTGTGATTGC -3'
(R):5'- CCCACTAAGGACTTGGACAG -3'

Sequencing Primer
(F):5'- CTGAAAGGTGTGATTGCAAAGAG -3'
(R):5'- GACTTGGACAGAGACACCCATG -3'
Posted On 2020-07-28