Incidental Mutation 'R8320:Grid2'
ID641899
Institutional Source Beutler Lab
Gene Symbol Grid2
Ensembl Gene ENSMUSG00000071424
Gene Nameglutamate receptor, ionotropic, delta 2
SynonymsGluRdelta2, tpr, B230104L07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8320 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location63255876-64704323 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 63256933 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 26 (I26T)
Ref Sequence ENSEMBL: ENSMUSP00000093536 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095852]
Predicted Effect probably benign
Transcript: ENSMUST00000095852
AA Change: I26T

PolyPhen 2 Score 0.150 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000093536
Gene: ENSMUSG00000071424
AA Change: I26T

DomainStartEndE-ValueType
Pfam:ANF_receptor 39 404 4.1e-41 PFAM
PBPe 442 807 5.98e-108 SMART
Lig_chan-Glu_bd 452 514 3.76e-24 SMART
transmembrane domain 830 852 N/A INTRINSIC
low complexity region 945 956 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159319
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159561
SMART Domains Protein: ENSMUSP00000125402
Gene: ENSMUSG00000071424

DomainStartEndE-ValueType
Pfam:ANF_receptor 39 404 2.7e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160408
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161105
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203390
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203667
Meta Mutation Damage Score 0.0645 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the family of ionotropic glutamate receptors which are the predominant excitatory neurotransmitter receptors in the mammalian brain. The encoded protein is a multi-pass membrane protein that is expressed selectively in cerebellar Purkinje cells. A point mutation in the mouse ortholog, associated with the phenotype named 'lurcher', in the heterozygous state leads to ataxia resulting from selective, cell-autonomous apoptosis of cerebellar Purkinje cells during postnatal development. Mice homozygous for this mutation die shortly after birth from massive loss of mid- and hindbrain neurons during late embryogenesis. This protein also plays a role in synapse organization between parallel fibers and Purkinje cells. Alternate splicing results in multiple transcript variants encoding distinct isoforms. Mutations in this gene cause cerebellar ataxia in humans. [provided by RefSeq, Apr 2014]
PHENOTYPE: Homozygotes for multiple spontaneous and targeted null mutations exhibit ataxia and impaired locomotion associated with cerebellar Purkinje cell abnormalities and loss, and on some backgrounds, male infertility due to lack of zona penetration by sperm. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asb10 A G 5: 24,537,628 probably null Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Clec3a T C 8: 114,425,629 V125A probably benign Het
Clspn A G 4: 126,563,950 D258G possibly damaging Het
Cnn3 T G 3: 121,449,986 L32R probably damaging Het
Cntnap5a T C 1: 116,446,736 F993L possibly damaging Het
Cobl A G 11: 12,267,001 S496P probably damaging Het
Dmxl2 A G 9: 54,383,759 V2469A probably benign Het
Dpcr1 T C 17: 35,643,638 T11A probably benign Het
Egfr T C 11: 16,891,251 F714S probably damaging Het
Erap1 G C 13: 74,666,549 E465Q probably benign Het
Ercc6 T C 14: 32,521,015 V204A probably benign Het
Fbln2 C T 6: 91,257,767 T689I possibly damaging Het
Fbxw13 G T 9: 109,183,066 T311K probably benign Het
Foxj2 T A 6: 122,833,690 S210T probably benign Het
Gnl1 A G 17: 35,982,598 N225S probably damaging Het
Gzmd A G 14: 56,129,733 I234T probably benign Het
Igkv2-137 GA GAA 6: 67,556,170 probably null Het
Kif26b T C 1: 178,884,076 probably null Het
Klk1b1 C T 7: 43,970,343 R109C possibly damaging Het
Klra10 A G 6: 130,269,248 C255R probably damaging Het
Lgi4 T C 7: 31,068,941 V455A probably benign Het
Neb C A 2: 52,296,331 V910L probably benign Het
Pigg G A 5: 108,347,851 R918H probably benign Het
Poln A G 5: 34,149,827 V10A possibly damaging Het
Polr1a T A 6: 71,941,384 M642K probably damaging Het
Rasal1 C T 5: 120,666,355 R431C probably benign Het
Rfc1 A T 5: 65,303,036 Y167* probably null Het
Rnf17 TG T 14: 56,424,542 probably null Het
Sars2 C T 7: 28,746,868 T174I probably damaging Het
Sept4 T C 11: 87,589,734 V398A possibly damaging Het
Slc6a2 C T 8: 92,992,848 T397I probably benign Het
Smarca4 G T 9: 21,677,502 R1200L probably benign Het
Stx7 G T 10: 24,179,148 A63S probably damaging Het
Sval3 G A 6: 41,972,524 V99I probably benign Het
Syna A G 5: 134,559,720 I125T possibly damaging Het
Syne2 T C 12: 76,103,830 S1827P probably damaging Het
Taf4b T C 18: 14,783,692 V33A possibly damaging Het
Tpcn2 C T 7: 145,266,622 R373H possibly damaging Het
Trpm1 A G 7: 64,268,793 D1511G possibly damaging Het
Ttc3 C A 16: 94,418,676 R487S probably damaging Het
Tubb3 T C 8: 123,420,855 S176P possibly damaging Het
Zfp189 C G 4: 49,530,180 Q428E probably benign Het
Zscan4d C T 7: 11,066,015 V316M probably benign Het
Other mutations in Grid2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00580:Grid2 APN 6 64345589 missense probably damaging 1.00
IGL00596:Grid2 APN 6 64533704 missense possibly damaging 0.93
IGL01686:Grid2 APN 6 64320196 missense probably benign 0.00
IGL01712:Grid2 APN 6 64665915 missense possibly damaging 0.73
IGL02064:Grid2 APN 6 64063935 missense probably benign 0.29
IGL02216:Grid2 APN 6 64345666 missense probably damaging 0.96
IGL02563:Grid2 APN 6 64345873 missense possibly damaging 0.94
IGL02685:Grid2 APN 6 64345816 missense possibly damaging 0.50
IGL03129:Grid2 APN 6 64063904 missense probably damaging 0.98
IGL03324:Grid2 APN 6 64429822 missense possibly damaging 0.88
IGL03395:Grid2 APN 6 63909069 missense possibly damaging 0.94
crawler UTSW 6 64429694 nonsense probably null
swagger UTSW 6 64395280 synonymous probably benign
R0133:Grid2 UTSW 6 64320132 missense probably damaging 1.00
R0147:Grid2 UTSW 6 64533587 missense probably benign
R0193:Grid2 UTSW 6 64063953 missense possibly damaging 0.64
R0370:Grid2 UTSW 6 64345734 missense possibly damaging 0.75
R0399:Grid2 UTSW 6 64666052 missense probably benign 0.33
R0600:Grid2 UTSW 6 63503435 missense probably benign 0.38
R0717:Grid2 UTSW 6 64666275 missense possibly damaging 0.96
R1524:Grid2 UTSW 6 64429754 missense possibly damaging 0.92
R1555:Grid2 UTSW 6 64429684 missense possibly damaging 0.87
R1572:Grid2 UTSW 6 64429694 nonsense probably null
R1762:Grid2 UTSW 6 64533654 missense probably damaging 0.98
R1944:Grid2 UTSW 6 63909061 missense probably damaging 1.00
R1961:Grid2 UTSW 6 63908893 missense probably damaging 1.00
R1969:Grid2 UTSW 6 63908918 nonsense probably null
R2138:Grid2 UTSW 6 64345798 missense probably damaging 0.99
R3500:Grid2 UTSW 6 63503399 missense probably damaging 0.97
R3547:Grid2 UTSW 6 64320021 missense probably damaging 0.97
R3845:Grid2 UTSW 6 64345842 missense possibly damaging 0.62
R4124:Grid2 UTSW 6 63503433 missense probably benign 0.41
R4273:Grid2 UTSW 6 63909045 missense probably damaging 1.00
R4591:Grid2 UTSW 6 64320102 missense probably damaging 1.00
R4701:Grid2 UTSW 6 64665915 missense probably benign 0.27
R4721:Grid2 UTSW 6 64666201 missense probably benign 0.33
R4755:Grid2 UTSW 6 63908988 missense probably benign 0.04
R4869:Grid2 UTSW 6 64429740 missense probably damaging 1.00
R5083:Grid2 UTSW 6 64320152 nonsense probably null
R5091:Grid2 UTSW 6 64076878 missense probably benign 0.07
R5117:Grid2 UTSW 6 63256933 missense probably benign 0.15
R5128:Grid2 UTSW 6 64665998 missense probably benign 0.01
R5386:Grid2 UTSW 6 63931105 missense probably damaging 0.99
R5404:Grid2 UTSW 6 63930910 missense probably damaging 0.99
R5534:Grid2 UTSW 6 63503361 missense probably benign
R5626:Grid2 UTSW 6 64076945 critical splice donor site probably null
R5699:Grid2 UTSW 6 63908991 missense probably damaging 0.99
R5700:Grid2 UTSW 6 64094432 missense possibly damaging 0.95
R5876:Grid2 UTSW 6 64663162 missense probably damaging 1.00
R6446:Grid2 UTSW 6 64345593 missense probably damaging 1.00
R6694:Grid2 UTSW 6 63931047 missense possibly damaging 0.92
R6697:Grid2 UTSW 6 63931047 missense possibly damaging 0.92
R6699:Grid2 UTSW 6 63931047 missense possibly damaging 0.92
R6767:Grid2 UTSW 6 63931015 missense probably benign 0.01
R6895:Grid2 UTSW 6 64395299 missense probably damaging 0.99
R6999:Grid2 UTSW 6 64076909 missense possibly damaging 0.80
R7053:Grid2 UTSW 6 64700418 missense unknown
R7126:Grid2 UTSW 6 64076810 missense probably damaging 0.99
R7432:Grid2 UTSW 6 64275870 missense possibly damaging 0.46
R7553:Grid2 UTSW 6 64076941 missense possibly damaging 0.95
R7619:Grid2 UTSW 6 63931101 missense possibly damaging 0.71
R7997:Grid2 UTSW 6 64320136 missense possibly damaging 0.89
R8112:Grid2 UTSW 6 63908907 missense probably damaging 0.99
R8296:Grid2 UTSW 6 63256945 critical splice donor site probably null
R8467:Grid2 UTSW 6 64533651 missense probably benign 0.01
R8691:Grid2 UTSW 6 63503337 missense probably damaging 0.97
R8890:Grid2 UTSW 6 63256939 missense probably benign
Z1176:Grid2 UTSW 6 63908879 missense possibly damaging 0.76
Z1176:Grid2 UTSW 6 64663228 missense probably benign 0.03
Z1177:Grid2 UTSW 6 64345856 nonsense probably null
Z1177:Grid2 UTSW 6 64345857 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGTGACCAGAAAAGATTGTGC -3'
(R):5'- CTCAGTCACTGCTTAGGGAAAG -3'

Sequencing Primer
(F):5'- GGGGAAAGCTGCACTCAACTC -3'
(R):5'- CTTAGGGAAAGCTGAGCCC -3'
Posted On2020-07-28