Incidental Mutation 'R8320:Igkv2-137'
ID641900
Institutional Source Beutler Lab
Gene Symbol Igkv2-137
Ensembl Gene ENSMUSG00000076501
Gene Nameimmunoglobulin kappa chain variable 2-137
SynonymsGm16955
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.164) question?
Stock #R8320 (G1)
Quality Score217.468
Status Not validated
Chromosome6
Chromosomal Location67555636-67556216 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) GA to GAA at 67556170 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000100103 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103302]
Predicted Effect probably null
Transcript: ENSMUST00000103302
SMART Domains Protein: ENSMUSP00000100103
Gene: ENSMUSG00000076501

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IGv 38 115 2.35e-18 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asb10 A G 5: 24,537,628 probably null Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Clec3a T C 8: 114,425,629 V125A probably benign Het
Clspn A G 4: 126,563,950 D258G possibly damaging Het
Cnn3 T G 3: 121,449,986 L32R probably damaging Het
Cntnap5a T C 1: 116,446,736 F993L possibly damaging Het
Cobl A G 11: 12,267,001 S496P probably damaging Het
Dmxl2 A G 9: 54,383,759 V2469A probably benign Het
Dpcr1 T C 17: 35,643,638 T11A probably benign Het
Egfr T C 11: 16,891,251 F714S probably damaging Het
Erap1 G C 13: 74,666,549 E465Q probably benign Het
Ercc6 T C 14: 32,521,015 V204A probably benign Het
Fbln2 C T 6: 91,257,767 T689I possibly damaging Het
Fbxw13 G T 9: 109,183,066 T311K probably benign Het
Foxj2 T A 6: 122,833,690 S210T probably benign Het
Gnl1 A G 17: 35,982,598 N225S probably damaging Het
Grid2 T C 6: 63,256,933 I26T probably benign Het
Gzmd A G 14: 56,129,733 I234T probably benign Het
Kif26b T C 1: 178,884,076 probably null Het
Klk1b1 C T 7: 43,970,343 R109C possibly damaging Het
Klra10 A G 6: 130,269,248 C255R probably damaging Het
Lgi4 T C 7: 31,068,941 V455A probably benign Het
Neb C A 2: 52,296,331 V910L probably benign Het
Pigg G A 5: 108,347,851 R918H probably benign Het
Poln A G 5: 34,149,827 V10A possibly damaging Het
Polr1a T A 6: 71,941,384 M642K probably damaging Het
Rasal1 C T 5: 120,666,355 R431C probably benign Het
Rfc1 A T 5: 65,303,036 Y167* probably null Het
Rnf17 TG T 14: 56,424,542 probably null Het
Sars2 C T 7: 28,746,868 T174I probably damaging Het
Sept4 T C 11: 87,589,734 V398A possibly damaging Het
Slc6a2 C T 8: 92,992,848 T397I probably benign Het
Smarca4 G T 9: 21,677,502 R1200L probably benign Het
Stx7 G T 10: 24,179,148 A63S probably damaging Het
Sval3 G A 6: 41,972,524 V99I probably benign Het
Syna A G 5: 134,559,720 I125T possibly damaging Het
Syne2 T C 12: 76,103,830 S1827P probably damaging Het
Taf4b T C 18: 14,783,692 V33A possibly damaging Het
Tpcn2 C T 7: 145,266,622 R373H possibly damaging Het
Trpm1 A G 7: 64,268,793 D1511G possibly damaging Het
Ttc3 C A 16: 94,418,676 R487S probably damaging Het
Tubb3 T C 8: 123,420,855 S176P possibly damaging Het
Zfp189 C G 4: 49,530,180 Q428E probably benign Het
Zscan4d C T 7: 11,066,015 V316M probably benign Het
Other mutations in Igkv2-137
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03268:Igkv2-137 APN 6 67556108 missense probably benign 0.18
R3914:Igkv2-137 UTSW 6 67555984 missense probably damaging 1.00
R4692:Igkv2-137 UTSW 6 67555987 missense possibly damaging 0.87
R5513:Igkv2-137 UTSW 6 67556014 missense possibly damaging 0.88
R8321:Igkv2-137 UTSW 6 67556170 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TCTCCTGCATAGTAATGGCAAC -3'
(R):5'- CATCTCCTGCAGAAAAGATGCTG -3'

Sequencing Primer
(F):5'- GGCAACACTTACTTGTATTGGTTC -3'
(R):5'- GGAAAGTCCCATTTCCTAGGGATTC -3'
Posted On2020-07-28