Incidental Mutation 'R8320:Zscan4d'
ID 641906
Institutional Source Beutler Lab
Gene Symbol Zscan4d
Ensembl Gene ENSMUSG00000090714
Gene Name zinc finger and SCAN domain containing 4D
Synonyms EG545913
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock # R8320 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 11161374-11166159 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 11066015 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 316 (V316M)
Ref Sequence ENSEMBL: ENSMUSP00000131258 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165848]
AlphaFold A7KBS4
Predicted Effect probably benign
Transcript: ENSMUST00000165848
AA Change: V316M

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000131258
Gene: ENSMUSG00000110103
AA Change: V316M

DomainStartEndE-ValueType
Pfam:SCAN 43 122 1.3e-17 PFAM
low complexity region 181 197 N/A INTRINSIC
ZnF_C2H2 395 417 5.14e-3 SMART
ZnF_C2H2 424 446 7.68e0 SMART
ZnF_C2H2 452 474 4.17e-3 SMART
ZnF_C2H2 480 503 3.83e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asb10 A G 5: 24,537,628 probably null Het
Bhlhe40 TG TGG 6: 108,664,857 254 probably null Het
Clec3a T C 8: 114,425,629 V125A probably benign Het
Clspn A G 4: 126,563,950 D258G possibly damaging Het
Cnn3 T G 3: 121,449,986 L32R probably damaging Het
Cntnap5a T C 1: 116,446,736 F993L possibly damaging Het
Cobl A G 11: 12,267,001 S496P probably damaging Het
Dmxl2 A G 9: 54,383,759 V2469A probably benign Het
Dpcr1 T C 17: 35,643,638 T11A probably benign Het
Egfr T C 11: 16,891,251 F714S probably damaging Het
Erap1 G C 13: 74,666,549 E465Q probably benign Het
Ercc6 T C 14: 32,521,015 V204A probably benign Het
Fbln2 C T 6: 91,257,767 T689I possibly damaging Het
Fbxw13 G T 9: 109,183,066 T311K probably benign Het
Foxj2 T A 6: 122,833,690 S210T probably benign Het
Gnl1 A G 17: 35,982,598 N225S probably damaging Het
Grid2 T C 6: 63,256,933 I26T probably benign Het
Gzmd A G 14: 56,129,733 I234T probably benign Het
Igkv2-137 GA GAA 6: 67,556,170 probably null Het
Kif26b T C 1: 178,884,076 probably null Het
Klk1b1 C T 7: 43,970,343 R109C possibly damaging Het
Klra10 A G 6: 130,269,248 C255R probably damaging Het
Lgi4 T C 7: 31,068,941 V455A probably benign Het
Neb C A 2: 52,296,331 V910L probably benign Het
Pigg G A 5: 108,347,851 R918H probably benign Het
Poln A G 5: 34,149,827 V10A possibly damaging Het
Polr1a T A 6: 71,941,384 M642K probably damaging Het
Rasal1 C T 5: 120,666,355 R431C probably benign Het
Rfc1 A T 5: 65,303,036 Y167* probably null Het
Rnf17 TG T 14: 56,424,542 132 probably null Het
Sars2 C T 7: 28,746,868 T174I probably damaging Het
Sept4 T C 11: 87,589,734 V398A possibly damaging Het
Slc6a2 C T 8: 92,992,848 T397I probably benign Het
Smarca4 G T 9: 21,677,502 R1200L probably benign Het
Stx7 G T 10: 24,179,148 A63S probably damaging Het
Sval3 G A 6: 41,972,524 V99I probably benign Het
Syna A G 5: 134,559,720 I125T possibly damaging Het
Syne2 T C 12: 76,103,830 S1827P probably damaging Het
Taf4b T C 18: 14,783,692 V33A possibly damaging Het
Tpcn2 C T 7: 145,266,622 R373H possibly damaging Het
Trpm1 A G 7: 64,268,793 D1511G possibly damaging Het
Ttc3 C A 16: 94,418,676 R487S probably damaging Het
Tubb3 T C 8: 123,420,855 S176P possibly damaging Het
Zfp189 C G 4: 49,530,180 Q428E probably benign Het
Other mutations in Zscan4d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Zscan4d APN 7 11162354 missense probably benign 0.00
IGL01576:Zscan4d APN 7 11162592 missense possibly damaging 0.91
IGL01926:Zscan4d APN 7 11164994 missense probably damaging 0.98
IGL02008:Zscan4d APN 7 11162369 missense probably benign 0.00
IGL02245:Zscan4d APN 7 11162789 missense probably benign
IGL02473:Zscan4d APN 7 11162409 missense probably benign 0.04
IGL02805:Zscan4d APN 7 11164970 splice site probably benign
IGL03010:Zscan4d APN 7 11163143 missense probably damaging 0.98
IGL03383:Zscan4d APN 7 11162765 missense probably benign 0.07
R0626:Zscan4d UTSW 7 11165019 missense probably damaging 0.97
R1084:Zscan4d UTSW 7 11165005 missense probably damaging 0.99
R1457:Zscan4d UTSW 7 11164994 missense probably damaging 0.98
R2426:Zscan4d UTSW 7 11165095 missense probably damaging 0.99
R2912:Zscan4d UTSW 7 11162687 missense probably benign
R3736:Zscan4d UTSW 7 11162876 missense probably benign
R4379:Zscan4d UTSW 7 11164978 missense probably benign
R4580:Zscan4d UTSW 7 11162508 missense probably benign 0.00
R4765:Zscan4d UTSW 7 11162667 missense probably benign 0.08
R4975:Zscan4d UTSW 7 11165347 start codon destroyed probably null 0.02
R6452:Zscan4d UTSW 7 11162072 missense probably damaging 0.98
R6570:Zscan4d UTSW 7 11162000 missense possibly damaging 0.92
R6680:Zscan4d UTSW 7 11162439 missense possibly damaging 0.85
R7726:Zscan4d UTSW 7 11165242 missense possibly damaging 0.65
R7772:Zscan4d UTSW 7 11162843 missense probably benign 0.28
R8282:Zscan4d UTSW 7 11162442 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- CACATGGTAAGTTTGCCTCATG -3'
(R):5'- TAGACTTCCGGAGTGCTCTG -3'

Sequencing Primer
(F):5'- AGTTTGCCTCATGATTCTTACCAAG -3'
(R):5'- GGATGTCCCCATGGAGGAAC -3'
Posted On 2020-07-28