Mutagenetix > Incidental Mutations

Incidental Mutation 'R8320:Zscan4d'

641906

Institutional Source

Beutler Lab

Gene Symbol

Zscan4d

Ensembl Gene

ENSMUSG00000090714

Gene Name

zinc finger and SCAN domain containing 4D

Synonyms

EG545913

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.107) question?

Stock #

R8320 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

11161374-11166159 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 11066015 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 316 (V316M)

Ref Sequence

ENSEMBL: ENSMUSP00000131258 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000165848]

AlphaFold

A7KBS4

Predicted Effect

probably benign
Transcript: ENSMUST00000165848
AA Change: V316M

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000131258
Gene: ENSMUSG00000110103
AA Change: V316M

Domain	Start	End	E-Value	Type
Pfam:SCAN	43	122	1.3e-17	PFAM
low complexity region	181	197	N/A	INTRINSIC
ZnF_C2H2	395	417	5.14e-3	SMART
ZnF_C2H2	424	446	7.68e0	SMART
ZnF_C2H2	452	474	4.17e-3	SMART
ZnF_C2H2	480	503	3.83e-2	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Asb10	A	G	5: 24,537,628		probably null	Het
Bhlhe40	TG	TGG	6: 108,664,857	254	probably null	Het
Clec3a	T	C	8: 114,425,629	V125A	probably benign	Het
Clspn	A	G	4: 126,563,950	D258G	possibly damaging	Het
Cnn3	T	G	3: 121,449,986	L32R	probably damaging	Het
Cntnap5a	T	C	1: 116,446,736	F993L	possibly damaging	Het
Cobl	A	G	11: 12,267,001	S496P	probably damaging	Het
Dmxl2	A	G	9: 54,383,759	V2469A	probably benign	Het
Dpcr1	T	C	17: 35,643,638	T11A	probably benign	Het
Egfr	T	C	11: 16,891,251	F714S	probably damaging	Het
Erap1	G	C	13: 74,666,549	E465Q	probably benign	Het
Ercc6	T	C	14: 32,521,015	V204A	probably benign	Het
Fbln2	C	T	6: 91,257,767	T689I	possibly damaging	Het
Fbxw13	G	T	9: 109,183,066	T311K	probably benign	Het
Foxj2	T	A	6: 122,833,690	S210T	probably benign	Het
Gnl1	A	G	17: 35,982,598	N225S	probably damaging	Het
Grid2	T	C	6: 63,256,933	I26T	probably benign	Het
Gzmd	A	G	14: 56,129,733	I234T	probably benign	Het
Igkv2-137	GA	GAA	6: 67,556,170		probably null	Het
Kif26b	T	C	1: 178,884,076		probably null	Het
Klk1b1	C	T	7: 43,970,343	R109C	possibly damaging	Het
Klra10	A	G	6: 130,269,248	C255R	probably damaging	Het
Lgi4	T	C	7: 31,068,941	V455A	probably benign	Het
Neb	C	A	2: 52,296,331	V910L	probably benign	Het
Pigg	G	A	5: 108,347,851	R918H	probably benign	Het
Poln	A	G	5: 34,149,827	V10A	possibly damaging	Het
Polr1a	T	A	6: 71,941,384	M642K	probably damaging	Het
Rasal1	C	T	5: 120,666,355	R431C	probably benign	Het
Rfc1	A	T	5: 65,303,036	Y167*	probably null	Het
Rnf17	TG	T	14: 56,424,542	132	probably null	Het
Sars2	C	T	7: 28,746,868	T174I	probably damaging	Het
Sept4	T	C	11: 87,589,734	V398A	possibly damaging	Het
Slc6a2	C	T	8: 92,992,848	T397I	probably benign	Het
Smarca4	G	T	9: 21,677,502	R1200L	probably benign	Het
Stx7	G	T	10: 24,179,148	A63S	probably damaging	Het
Sval3	G	A	6: 41,972,524	V99I	probably benign	Het
Syna	A	G	5: 134,559,720	I125T	possibly damaging	Het
Syne2	T	C	12: 76,103,830	S1827P	probably damaging	Het
Taf4b	T	C	18: 14,783,692	V33A	possibly damaging	Het
Tpcn2	C	T	7: 145,266,622	R373H	possibly damaging	Het
Trpm1	A	G	7: 64,268,793	D1511G	possibly damaging	Het
Ttc3	C	A	16: 94,418,676	R487S	probably damaging	Het
Tubb3	T	C	8: 123,420,855	S176P	possibly damaging	Het
Zfp189	C	G	4: 49,530,180	Q428E	probably benign	Het

Other mutations in Zscan4d

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00518:Zscan4d	APN	7	11162354	missense	probably benign	0.00
IGL01576:Zscan4d	APN	7	11162592	missense	possibly damaging	0.91
IGL01926:Zscan4d	APN	7	11164994	missense	probably damaging	0.98
IGL02008:Zscan4d	APN	7	11162369	missense	probably benign	0.00
IGL02245:Zscan4d	APN	7	11162789	missense	probably benign
IGL02473:Zscan4d	APN	7	11162409	missense	probably benign	0.04
IGL02805:Zscan4d	APN	7	11164970	splice site	probably benign
IGL03010:Zscan4d	APN	7	11163143	missense	probably damaging	0.98
IGL03383:Zscan4d	APN	7	11162765	missense	probably benign	0.07
R0626:Zscan4d	UTSW	7	11165019	missense	probably damaging	0.97
R1084:Zscan4d	UTSW	7	11165005	missense	probably damaging	0.99
R1457:Zscan4d	UTSW	7	11164994	missense	probably damaging	0.98
R2426:Zscan4d	UTSW	7	11165095	missense	probably damaging	0.99
R2912:Zscan4d	UTSW	7	11162687	missense	probably benign
R3736:Zscan4d	UTSW	7	11162876	missense	probably benign
R4379:Zscan4d	UTSW	7	11164978	missense	probably benign
R4580:Zscan4d	UTSW	7	11162508	missense	probably benign	0.00
R4765:Zscan4d	UTSW	7	11162667	missense	probably benign	0.08
R4975:Zscan4d	UTSW	7	11165347	start codon destroyed	probably null	0.02
R6452:Zscan4d	UTSW	7	11162072	missense	probably damaging	0.98
R6570:Zscan4d	UTSW	7	11162000	missense	possibly damaging	0.92
R6680:Zscan4d	UTSW	7	11162439	missense	possibly damaging	0.85
R7726:Zscan4d	UTSW	7	11165242	missense	possibly damaging	0.65
R7772:Zscan4d	UTSW	7	11162843	missense	probably benign	0.28
R8282:Zscan4d	UTSW	7	11162442	missense	possibly damaging	0.91

Predicted Primers

PCR Primer
(F):5'- CACATGGTAAGTTTGCCTCATG -3'
(R):5'- TAGACTTCCGGAGTGCTCTG -3'

Sequencing Primer
(F):5'- AGTTTGCCTCATGATTCTTACCAAG -3'
(R):5'- GGATGTCCCCATGGAGGAAC -3'

Posted On

2020-07-28