Incidental Mutation 'R8320:Lgi4'
ID641908
Institutional Source Beutler Lab
Gene Symbol Lgi4
Ensembl Gene ENSMUSG00000036560
Gene Nameleucine-rich repeat LGI family, member 4
Synonymsclp
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8320 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location31059342-31070935 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 31068941 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 455 (V455A)
Ref Sequence ENSEMBL: ENSMUSP00000041579 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039775] [ENSMUST00000072331] [ENSMUST00000164725] [ENSMUST00000167369] [ENSMUST00000171359]
Predicted Effect probably benign
Transcript: ENSMUST00000039775
AA Change: V455A

PolyPhen 2 Score 0.136 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000041579
Gene: ENSMUSG00000036560
AA Change: V455A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 49 59 N/A INTRINSIC
LRR 75 98 7.17e1 SMART
LRR 99 122 2.76e1 SMART
LRR_TYP 123 146 2.43e-4 SMART
LRRCT 158 207 3.97e-5 SMART
Pfam:EPTP 214 251 1.1e-7 PFAM
Pfam:EPTP 396 438 2.7e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000072331
Predicted Effect probably benign
Transcript: ENSMUST00000072331
Predicted Effect probably benign
Transcript: ENSMUST00000164725
Predicted Effect probably benign
Transcript: ENSMUST00000167369
SMART Domains Protein: ENSMUSP00000130245
Gene: ENSMUSG00000057092

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ATP1G1_PLM_MAT8 25 71 5.5e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171359
SMART Domains Protein: ENSMUSP00000128610
Gene: ENSMUSG00000057092

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ATP1G1_PLM_MAT8 23 72 4.9e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172001
SMART Domains Protein: ENSMUSP00000125865
Gene: ENSMUSG00000036560

DomainStartEndE-ValueType
LRRCT 9 58 3.97e-5 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutant animals have an abnormal posture where the forelimbs are flexed and rotated inwards. The peripheral nervous system is delayed in myelination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asb10 A G 5: 24,537,628 probably null Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Clec3a T C 8: 114,425,629 V125A probably benign Het
Clspn A G 4: 126,563,950 D258G possibly damaging Het
Cnn3 T G 3: 121,449,986 L32R probably damaging Het
Cntnap5a T C 1: 116,446,736 F993L possibly damaging Het
Cobl A G 11: 12,267,001 S496P probably damaging Het
Dmxl2 A G 9: 54,383,759 V2469A probably benign Het
Dpcr1 T C 17: 35,643,638 T11A probably benign Het
Egfr T C 11: 16,891,251 F714S probably damaging Het
Erap1 G C 13: 74,666,549 E465Q probably benign Het
Ercc6 T C 14: 32,521,015 V204A probably benign Het
Fbln2 C T 6: 91,257,767 T689I possibly damaging Het
Fbxw13 G T 9: 109,183,066 T311K probably benign Het
Foxj2 T A 6: 122,833,690 S210T probably benign Het
Gnl1 A G 17: 35,982,598 N225S probably damaging Het
Grid2 T C 6: 63,256,933 I26T probably benign Het
Gzmd A G 14: 56,129,733 I234T probably benign Het
Igkv2-137 GA GAA 6: 67,556,170 probably null Het
Kif26b T C 1: 178,884,076 probably null Het
Klk1b1 C T 7: 43,970,343 R109C possibly damaging Het
Klra10 A G 6: 130,269,248 C255R probably damaging Het
Neb C A 2: 52,296,331 V910L probably benign Het
Pigg G A 5: 108,347,851 R918H probably benign Het
Poln A G 5: 34,149,827 V10A possibly damaging Het
Polr1a T A 6: 71,941,384 M642K probably damaging Het
Rasal1 C T 5: 120,666,355 R431C probably benign Het
Rfc1 A T 5: 65,303,036 Y167* probably null Het
Rnf17 TG T 14: 56,424,542 probably null Het
Sars2 C T 7: 28,746,868 T174I probably damaging Het
Sept4 T C 11: 87,589,734 V398A possibly damaging Het
Slc6a2 C T 8: 92,992,848 T397I probably benign Het
Smarca4 G T 9: 21,677,502 R1200L probably benign Het
Stx7 G T 10: 24,179,148 A63S probably damaging Het
Sval3 G A 6: 41,972,524 V99I probably benign Het
Syna A G 5: 134,559,720 I125T possibly damaging Het
Syne2 T C 12: 76,103,830 S1827P probably damaging Het
Taf4b T C 18: 14,783,692 V33A possibly damaging Het
Tpcn2 C T 7: 145,266,622 R373H possibly damaging Het
Trpm1 A G 7: 64,268,793 D1511G possibly damaging Het
Ttc3 C A 16: 94,418,676 R487S probably damaging Het
Tubb3 T C 8: 123,420,855 S176P possibly damaging Het
Zfp189 C G 4: 49,530,180 Q428E probably benign Het
Zscan4d C T 7: 11,066,015 V316M probably benign Het
Other mutations in Lgi4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01288:Lgi4 APN 7 31069043 missense probably benign 0.01
IGL01624:Lgi4 APN 7 31067688 missense probably damaging 1.00
IGL02251:Lgi4 APN 7 31067263 splice site probably null
IGL02755:Lgi4 APN 7 31063105 missense probably damaging 1.00
IGL03153:Lgi4 APN 7 31060558 missense probably damaging 1.00
IGL03392:Lgi4 APN 7 31063180 splice site probably null
R0060:Lgi4 UTSW 7 31063571 missense probably damaging 0.97
R0575:Lgi4 UTSW 7 31060093 missense probably benign 0.12
R2139:Lgi4 UTSW 7 31063123 missense probably damaging 1.00
R2276:Lgi4 UTSW 7 31060612 missense probably damaging 1.00
R2277:Lgi4 UTSW 7 31060612 missense probably damaging 1.00
R2278:Lgi4 UTSW 7 31060612 missense probably damaging 1.00
R2939:Lgi4 UTSW 7 31067828 nonsense probably null
R3039:Lgi4 UTSW 7 31060067 missense probably benign
R3922:Lgi4 UTSW 7 31067448 missense probably benign
R4650:Lgi4 UTSW 7 31069129 missense probably benign 0.38
R5184:Lgi4 UTSW 7 31070757 unclassified probably benign
R5583:Lgi4 UTSW 7 31061137 missense possibly damaging 0.92
R5837:Lgi4 UTSW 7 31070783 unclassified probably benign
R5917:Lgi4 UTSW 7 31060178 missense possibly damaging 0.76
R6198:Lgi4 UTSW 7 31069122 splice site probably null
R6454:Lgi4 UTSW 7 31060132 missense probably benign
R6845:Lgi4 UTSW 7 31061085 missense probably damaging 0.99
R6897:Lgi4 UTSW 7 31068890 missense probably benign 0.00
R7232:Lgi4 UTSW 7 31067351 missense possibly damaging 0.67
R7354:Lgi4 UTSW 7 31060622 missense probably damaging 1.00
R8224:Lgi4 UTSW 7 31063592 missense probably damaging 1.00
R8257:Lgi4 UTSW 7 31067341 critical splice acceptor site probably null
R8440:Lgi4 UTSW 7 31060624 critical splice donor site probably null
R8469:Lgi4 UTSW 7 31067640 missense probably damaging 1.00
Z1186:Lgi4 UTSW 7 31069171 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- TATAACAATGCCCCGTTCCAAG -3'
(R):5'- TACGGTGACTTGGGCAAAGG -3'

Sequencing Primer
(F):5'- ATCAGTCAGTGCCAGGCTAG -3'
(R):5'- AAAGGCTCGAGGGGCCAC -3'
Posted On2020-07-28