Incidental Mutation 'R8320:Trpm1'
ID 641910
Institutional Source Beutler Lab
Gene Symbol Trpm1
Ensembl Gene ENSMUSG00000030523
Gene Name transient receptor potential cation channel, subfamily M, member 1
Synonyms Mlsn1, melastatin, 4732499L03Rik, LTRPC1
MMRRC Submission 067722-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8320 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 63803583-63919523 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 63918541 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 1511 (D1511G)
Ref Sequence ENSEMBL: ENSMUSP00000082318 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085222] [ENSMUST00000206263] [ENSMUST00000206277] [ENSMUST00000206314] [ENSMUST00000206848]
AlphaFold Q2TV84
Predicted Effect possibly damaging
Transcript: ENSMUST00000085222
AA Change: D1511G

PolyPhen 2 Score 0.555 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000082318
Gene: ENSMUSG00000030523
AA Change: D1511G

DomainStartEndE-ValueType
low complexity region 8 28 N/A INTRINSIC
low complexity region 183 195 N/A INTRINSIC
low complexity region 289 307 N/A INTRINSIC
low complexity region 456 491 N/A INTRINSIC
Blast:ANK 505 533 1e-5 BLAST
low complexity region 621 650 N/A INTRINSIC
low complexity region 823 835 N/A INTRINSIC
transmembrane domain 876 895 N/A INTRINSIC
Pfam:Ion_trans 907 1120 6e-16 PFAM
transmembrane domain 1150 1167 N/A INTRINSIC
low complexity region 1216 1225 N/A INTRINSIC
PDB:3E7K|H 1228 1279 1e-7 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000206263
AA Change: D1395G

PolyPhen 2 Score 0.555 (Sensitivity: 0.88; Specificity: 0.91)
Predicted Effect probably benign
Transcript: ENSMUST00000206277
AA Change: D1517G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably damaging
Transcript: ENSMUST00000206314
AA Change: D627G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000206848
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the transient receptor potential melastatin subfamily of transient receptor potential ion channels. The encoded protein is a calcium permeable cation channel that is expressed in melanocytes and may play a role in melanin synthesis. Specific mutations in this gene are the cause autosomal recessive complete congenital stationary night blindness-1C. The expression of this protein is inversely correlated with melanoma aggressiveness and as such it is used as a prognostic marker for melanoma metastasis. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous mutants have defects in rod and cone electrophysiology affecting the photoresponses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asb10 A G 5: 24,742,626 (GRCm39) probably null Het
Bhlhe40 TG TGG 6: 108,641,818 (GRCm39) 254 probably null Het
Clec3a T C 8: 115,152,369 (GRCm39) V125A probably benign Het
Clspn A G 4: 126,457,743 (GRCm39) D258G possibly damaging Het
Cnn3 T G 3: 121,243,635 (GRCm39) L32R probably damaging Het
Cntnap5a T C 1: 116,374,466 (GRCm39) F993L possibly damaging Het
Cobl A G 11: 12,217,001 (GRCm39) S496P probably damaging Het
Dmxl2 A G 9: 54,291,043 (GRCm39) V2469A probably benign Het
Egfr T C 11: 16,841,251 (GRCm39) F714S probably damaging Het
Erap1 G C 13: 74,814,668 (GRCm39) E465Q probably benign Het
Ercc6 T C 14: 32,242,972 (GRCm39) V204A probably benign Het
Fbln2 C T 6: 91,234,749 (GRCm39) T689I possibly damaging Het
Fbxw13 G T 9: 109,012,134 (GRCm39) T311K probably benign Het
Foxj2 T A 6: 122,810,649 (GRCm39) S210T probably benign Het
Gnl1 A G 17: 36,293,490 (GRCm39) N225S probably damaging Het
Grid2 T C 6: 63,233,917 (GRCm39) I26T probably benign Het
Gzmd A G 14: 56,367,190 (GRCm39) I234T probably benign Het
Igkv2-137 GA GAA 6: 67,533,154 (GRCm39) probably null Het
Kif26b T C 1: 178,711,641 (GRCm39) probably null Het
Klk1b1 C T 7: 43,619,767 (GRCm39) R109C possibly damaging Het
Klra10 A G 6: 130,246,211 (GRCm39) C255R probably damaging Het
Lgi4 T C 7: 30,768,366 (GRCm39) V455A probably benign Het
Mucl3 T C 17: 35,954,530 (GRCm39) T11A probably benign Het
Neb C A 2: 52,186,343 (GRCm39) V910L probably benign Het
Pigg G A 5: 108,495,717 (GRCm39) R918H probably benign Het
Poln A G 5: 34,307,171 (GRCm39) V10A possibly damaging Het
Polr1a T A 6: 71,918,368 (GRCm39) M642K probably damaging Het
Rasal1 C T 5: 120,804,420 (GRCm39) R431C probably benign Het
Rfc1 A T 5: 65,460,379 (GRCm39) Y167* probably null Het
Rnf17 TG T 14: 56,661,999 (GRCm39) 132 probably null Het
Sars2 C T 7: 28,446,293 (GRCm39) T174I probably damaging Het
Septin4 T C 11: 87,480,560 (GRCm39) V398A possibly damaging Het
Slc6a2 C T 8: 93,719,476 (GRCm39) T397I probably benign Het
Smarca4 G T 9: 21,588,798 (GRCm39) R1200L probably benign Het
Stx7 G T 10: 24,055,046 (GRCm39) A63S probably damaging Het
Sval3 G A 6: 41,949,458 (GRCm39) V99I probably benign Het
Syna A G 5: 134,588,574 (GRCm39) I125T possibly damaging Het
Syne2 T C 12: 76,150,604 (GRCm39) S1827P probably damaging Het
Taf4b T C 18: 14,916,749 (GRCm39) V33A possibly damaging Het
Tpcn2 C T 7: 144,820,359 (GRCm39) R373H possibly damaging Het
Ttc3 C A 16: 94,219,535 (GRCm39) R487S probably damaging Het
Tubb3 T C 8: 124,147,594 (GRCm39) S176P possibly damaging Het
Zfp189 C G 4: 49,530,180 (GRCm39) Q428E probably benign Het
Zscan4d C T 7: 10,799,942 (GRCm39) V316M probably benign Het
Other mutations in Trpm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Trpm1 APN 7 63,893,198 (GRCm39) missense probably damaging 1.00
IGL00465:Trpm1 APN 7 63,897,215 (GRCm39) missense possibly damaging 0.94
IGL01118:Trpm1 APN 7 63,885,572 (GRCm39) missense probably benign 0.24
IGL01148:Trpm1 APN 7 63,893,312 (GRCm39) missense probably damaging 1.00
IGL01303:Trpm1 APN 7 63,860,578 (GRCm39) critical splice acceptor site probably benign 0.00
IGL01432:Trpm1 APN 7 63,884,767 (GRCm39) missense probably benign 0.18
IGL01433:Trpm1 APN 7 63,854,276 (GRCm39) missense probably damaging 1.00
IGL01506:Trpm1 APN 7 63,893,329 (GRCm39) missense probably damaging 1.00
IGL01626:Trpm1 APN 7 63,918,637 (GRCm39) missense probably damaging 1.00
IGL01640:Trpm1 APN 7 63,876,645 (GRCm39) missense probably damaging 1.00
IGL01899:Trpm1 APN 7 63,884,742 (GRCm39) missense probably benign 0.24
IGL01959:Trpm1 APN 7 63,858,723 (GRCm39) missense possibly damaging 0.81
IGL02210:Trpm1 APN 7 63,860,613 (GRCm39) missense probably damaging 1.00
IGL02268:Trpm1 APN 7 63,867,362 (GRCm39) missense probably damaging 0.96
IGL02331:Trpm1 APN 7 63,884,800 (GRCm39) missense probably benign 0.30
IGL02334:Trpm1 APN 7 63,895,690 (GRCm39) critical splice acceptor site probably null
IGL02407:Trpm1 APN 7 63,868,869 (GRCm39) missense probably damaging 1.00
IGL02425:Trpm1 APN 7 63,890,175 (GRCm39) missense probably damaging 0.96
IGL02485:Trpm1 APN 7 63,918,862 (GRCm39) missense possibly damaging 0.52
IGL02635:Trpm1 APN 7 63,848,972 (GRCm39) missense probably benign 0.00
IGL02640:Trpm1 APN 7 63,868,881 (GRCm39) missense probably damaging 0.97
IGL02827:Trpm1 APN 7 63,868,908 (GRCm39) missense probably null 1.00
PIT4458001:Trpm1 UTSW 7 63,918,309 (GRCm39) missense possibly damaging 0.94
PIT4544001:Trpm1 UTSW 7 63,848,998 (GRCm39) intron probably benign
R0012:Trpm1 UTSW 7 63,918,339 (GRCm39) missense possibly damaging 0.88
R0014:Trpm1 UTSW 7 63,897,970 (GRCm39) missense probably damaging 1.00
R0056:Trpm1 UTSW 7 63,893,334 (GRCm39) missense probably damaging 1.00
R0445:Trpm1 UTSW 7 63,894,590 (GRCm39) unclassified probably benign
R0463:Trpm1 UTSW 7 63,870,002 (GRCm39) missense probably benign 0.05
R0469:Trpm1 UTSW 7 63,873,506 (GRCm39) missense probably damaging 1.00
R0510:Trpm1 UTSW 7 63,873,506 (GRCm39) missense probably damaging 1.00
R1301:Trpm1 UTSW 7 63,852,801 (GRCm39) splice site probably null
R1397:Trpm1 UTSW 7 63,867,406 (GRCm39) missense probably damaging 1.00
R1588:Trpm1 UTSW 7 63,873,565 (GRCm39) missense possibly damaging 0.93
R1618:Trpm1 UTSW 7 63,890,283 (GRCm39) missense probably damaging 1.00
R1724:Trpm1 UTSW 7 63,885,569 (GRCm39) nonsense probably null
R1827:Trpm1 UTSW 7 63,884,755 (GRCm39) missense probably damaging 1.00
R1829:Trpm1 UTSW 7 63,876,530 (GRCm39) missense probably damaging 1.00
R1835:Trpm1 UTSW 7 63,880,016 (GRCm39) missense probably damaging 1.00
R1864:Trpm1 UTSW 7 63,917,764 (GRCm39) missense probably damaging 1.00
R1895:Trpm1 UTSW 7 63,873,556 (GRCm39) missense probably damaging 1.00
R1946:Trpm1 UTSW 7 63,873,556 (GRCm39) missense probably damaging 1.00
R1959:Trpm1 UTSW 7 63,879,978 (GRCm39) missense probably damaging 1.00
R1960:Trpm1 UTSW 7 63,879,978 (GRCm39) missense probably damaging 1.00
R1980:Trpm1 UTSW 7 63,858,182 (GRCm39) missense possibly damaging 0.83
R1989:Trpm1 UTSW 7 63,858,780 (GRCm39) intron probably null
R2054:Trpm1 UTSW 7 63,890,303 (GRCm39) missense possibly damaging 0.69
R2156:Trpm1 UTSW 7 63,884,736 (GRCm39) missense probably damaging 1.00
R2251:Trpm1 UTSW 7 63,859,724 (GRCm39) missense probably damaging 1.00
R3051:Trpm1 UTSW 7 63,918,849 (GRCm39) missense probably damaging 1.00
R3148:Trpm1 UTSW 7 63,884,760 (GRCm39) missense probably benign 0.00
R3195:Trpm1 UTSW 7 63,849,061 (GRCm39) nonsense probably null
R3615:Trpm1 UTSW 7 63,893,318 (GRCm39) missense probably damaging 1.00
R3616:Trpm1 UTSW 7 63,893,318 (GRCm39) missense probably damaging 1.00
R3623:Trpm1 UTSW 7 63,894,601 (GRCm39) missense probably damaging 1.00
R3624:Trpm1 UTSW 7 63,894,601 (GRCm39) missense probably damaging 1.00
R3721:Trpm1 UTSW 7 63,867,475 (GRCm39) intron probably benign
R3822:Trpm1 UTSW 7 63,867,451 (GRCm39) intron probably benign
R4441:Trpm1 UTSW 7 63,851,666 (GRCm39) missense probably damaging 1.00
R4490:Trpm1 UTSW 7 63,858,660 (GRCm39) nonsense probably null
R4666:Trpm1 UTSW 7 63,852,782 (GRCm39) missense probably damaging 1.00
R4701:Trpm1 UTSW 7 63,893,248 (GRCm39) missense probably damaging 1.00
R4781:Trpm1 UTSW 7 63,884,800 (GRCm39) missense probably benign 0.30
R4811:Trpm1 UTSW 7 63,858,054 (GRCm39) missense probably damaging 1.00
R5017:Trpm1 UTSW 7 63,894,580 (GRCm39) unclassified probably benign
R5030:Trpm1 UTSW 7 63,885,579 (GRCm39) missense probably damaging 1.00
R5195:Trpm1 UTSW 7 63,887,441 (GRCm39) missense possibly damaging 0.84
R5238:Trpm1 UTSW 7 63,918,702 (GRCm39) missense probably damaging 1.00
R5304:Trpm1 UTSW 7 63,858,694 (GRCm39) missense probably benign 0.00
R5575:Trpm1 UTSW 7 63,870,018 (GRCm39) missense possibly damaging 0.95
R5613:Trpm1 UTSW 7 63,858,159 (GRCm39) missense probably damaging 1.00
R5855:Trpm1 UTSW 7 63,918,710 (GRCm39) nonsense probably null
R5947:Trpm1 UTSW 7 63,873,547 (GRCm39) missense probably benign 0.07
R5988:Trpm1 UTSW 7 63,876,553 (GRCm39) missense probably benign 0.16
R6054:Trpm1 UTSW 7 63,918,450 (GRCm39) missense probably benign 0.00
R6088:Trpm1 UTSW 7 63,917,724 (GRCm39) missense probably damaging 0.98
R6259:Trpm1 UTSW 7 63,918,226 (GRCm39) missense possibly damaging 0.47
R6379:Trpm1 UTSW 7 63,848,942 (GRCm39) missense probably benign 0.00
R6380:Trpm1 UTSW 7 63,918,045 (GRCm39) missense probably benign 0.24
R6429:Trpm1 UTSW 7 63,918,252 (GRCm39) missense probably benign 0.00
R6600:Trpm1 UTSW 7 63,803,781 (GRCm39) start codon destroyed probably null 0.56
R6622:Trpm1 UTSW 7 63,890,343 (GRCm39) missense probably damaging 0.96
R6939:Trpm1 UTSW 7 63,918,045 (GRCm39) missense probably benign 0.03
R6944:Trpm1 UTSW 7 63,893,181 (GRCm39) missense probably damaging 1.00
R7025:Trpm1 UTSW 7 63,876,462 (GRCm39) critical splice acceptor site probably null
R7112:Trpm1 UTSW 7 63,885,593 (GRCm39) missense probably damaging 0.97
R7168:Trpm1 UTSW 7 63,918,445 (GRCm39) missense probably benign 0.01
R7219:Trpm1 UTSW 7 63,854,333 (GRCm39) missense possibly damaging 0.68
R7224:Trpm1 UTSW 7 63,868,854 (GRCm39) critical splice acceptor site probably null
R7285:Trpm1 UTSW 7 63,859,729 (GRCm39) nonsense probably null
R7367:Trpm1 UTSW 7 63,918,549 (GRCm39) missense probably benign 0.06
R7449:Trpm1 UTSW 7 63,858,723 (GRCm39) missense probably benign 0.14
R7466:Trpm1 UTSW 7 63,890,330 (GRCm39) missense probably damaging 0.99
R7498:Trpm1 UTSW 7 63,858,657 (GRCm39) missense possibly damaging 0.93
R7581:Trpm1 UTSW 7 63,854,303 (GRCm39) missense probably benign 0.00
R7776:Trpm1 UTSW 7 63,897,939 (GRCm39) missense probably benign 0.04
R8062:Trpm1 UTSW 7 63,851,689 (GRCm39) missense probably benign 0.18
R8069:Trpm1 UTSW 7 63,858,718 (GRCm39) missense possibly damaging 0.55
R8157:Trpm1 UTSW 7 63,849,017 (GRCm39) missense probably damaging 1.00
R8219:Trpm1 UTSW 7 63,851,699 (GRCm39) missense probably benign 0.35
R8258:Trpm1 UTSW 7 63,918,777 (GRCm39) missense probably benign 0.10
R8259:Trpm1 UTSW 7 63,918,777 (GRCm39) missense probably benign 0.10
R8536:Trpm1 UTSW 7 63,897,155 (GRCm39) missense probably damaging 1.00
R8544:Trpm1 UTSW 7 63,874,356 (GRCm39) splice site probably null
R8813:Trpm1 UTSW 7 63,851,756 (GRCm39) missense possibly damaging 0.68
R8912:Trpm1 UTSW 7 63,918,628 (GRCm39) missense probably benign 0.06
R8954:Trpm1 UTSW 7 63,858,089 (GRCm39) missense probably damaging 0.98
R9139:Trpm1 UTSW 7 63,848,943 (GRCm39) missense probably benign 0.00
R9205:Trpm1 UTSW 7 63,890,319 (GRCm39) missense possibly damaging 0.66
R9258:Trpm1 UTSW 7 63,884,713 (GRCm39) missense probably benign 0.01
R9283:Trpm1 UTSW 7 63,873,623 (GRCm39) missense probably benign 0.18
R9394:Trpm1 UTSW 7 63,918,480 (GRCm39) missense probably benign 0.00
R9430:Trpm1 UTSW 7 63,873,446 (GRCm39) missense probably benign 0.38
R9537:Trpm1 UTSW 7 63,803,616 (GRCm39) unclassified probably benign
R9616:Trpm1 UTSW 7 63,858,132 (GRCm39) missense probably damaging 0.99
R9774:Trpm1 UTSW 7 63,898,041 (GRCm39) missense possibly damaging 0.90
X0026:Trpm1 UTSW 7 63,918,658 (GRCm39) missense probably benign 0.05
Z1176:Trpm1 UTSW 7 63,854,342 (GRCm39) critical splice donor site probably null
Z1176:Trpm1 UTSW 7 63,852,879 (GRCm39) critical splice donor site probably null
Z1177:Trpm1 UTSW 7 63,867,439 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- AAACTCGTGCGCTACTACCC -3'
(R):5'- CTAGGACGGCCATGTAAACTTC -3'

Sequencing Primer
(F):5'- CGCTACTACCCCGGAGAC -3'
(R):5'- GGACGGCCATGTAAACTTCTTGAC -3'
Posted On 2020-07-28