Incidental Mutation 'R8320:Fbxw13'
ID 641917
Institutional Source Beutler Lab
Gene Symbol Fbxw13
Ensembl Gene ENSMUSG00000049314
Gene Name F-box and WD-40 domain protein 13
Synonyms
MMRRC Submission 067722-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.057) question?
Stock # R8320 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 109008295-109025043 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 109012134 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Lysine at position 311 (T311K)
Ref Sequence ENSEMBL: ENSMUSP00000053786 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061456] [ENSMUST00000199102] [ENSMUST00000199118]
AlphaFold Q8BI57
Predicted Effect probably benign
Transcript: ENSMUST00000061456
AA Change: T311K

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000053786
Gene: ENSMUSG00000049314
AA Change: T311K

DomainStartEndE-ValueType
FBOX 5 45 9.33e-5 SMART
SCOP:d1gxra_ 128 249 8e-7 SMART
Blast:WD40 137 176 2e-7 BLAST
low complexity region 421 432 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199102
AA Change: T228K

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000142352
Gene: ENSMUSG00000049314
AA Change: T228K

DomainStartEndE-ValueType
SCOP:d1gxra_ 45 166 1e-7 SMART
Blast:WD40 54 93 7e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000199118
SMART Domains Protein: ENSMUSP00000143174
Gene: ENSMUSG00000049314

DomainStartEndE-ValueType
FBOX 5 45 3.25e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asb10 A G 5: 24,742,626 (GRCm39) probably null Het
Bhlhe40 TG TGG 6: 108,641,818 (GRCm39) 254 probably null Het
Clec3a T C 8: 115,152,369 (GRCm39) V125A probably benign Het
Clspn A G 4: 126,457,743 (GRCm39) D258G possibly damaging Het
Cnn3 T G 3: 121,243,635 (GRCm39) L32R probably damaging Het
Cntnap5a T C 1: 116,374,466 (GRCm39) F993L possibly damaging Het
Cobl A G 11: 12,217,001 (GRCm39) S496P probably damaging Het
Dmxl2 A G 9: 54,291,043 (GRCm39) V2469A probably benign Het
Egfr T C 11: 16,841,251 (GRCm39) F714S probably damaging Het
Erap1 G C 13: 74,814,668 (GRCm39) E465Q probably benign Het
Ercc6 T C 14: 32,242,972 (GRCm39) V204A probably benign Het
Fbln2 C T 6: 91,234,749 (GRCm39) T689I possibly damaging Het
Foxj2 T A 6: 122,810,649 (GRCm39) S210T probably benign Het
Gnl1 A G 17: 36,293,490 (GRCm39) N225S probably damaging Het
Grid2 T C 6: 63,233,917 (GRCm39) I26T probably benign Het
Gzmd A G 14: 56,367,190 (GRCm39) I234T probably benign Het
Igkv2-137 GA GAA 6: 67,533,154 (GRCm39) probably null Het
Kif26b T C 1: 178,711,641 (GRCm39) probably null Het
Klk1b1 C T 7: 43,619,767 (GRCm39) R109C possibly damaging Het
Klra10 A G 6: 130,246,211 (GRCm39) C255R probably damaging Het
Lgi4 T C 7: 30,768,366 (GRCm39) V455A probably benign Het
Mucl3 T C 17: 35,954,530 (GRCm39) T11A probably benign Het
Neb C A 2: 52,186,343 (GRCm39) V910L probably benign Het
Pigg G A 5: 108,495,717 (GRCm39) R918H probably benign Het
Poln A G 5: 34,307,171 (GRCm39) V10A possibly damaging Het
Polr1a T A 6: 71,918,368 (GRCm39) M642K probably damaging Het
Rasal1 C T 5: 120,804,420 (GRCm39) R431C probably benign Het
Rfc1 A T 5: 65,460,379 (GRCm39) Y167* probably null Het
Rnf17 TG T 14: 56,661,999 (GRCm39) 132 probably null Het
Sars2 C T 7: 28,446,293 (GRCm39) T174I probably damaging Het
Septin4 T C 11: 87,480,560 (GRCm39) V398A possibly damaging Het
Slc6a2 C T 8: 93,719,476 (GRCm39) T397I probably benign Het
Smarca4 G T 9: 21,588,798 (GRCm39) R1200L probably benign Het
Stx7 G T 10: 24,055,046 (GRCm39) A63S probably damaging Het
Sval3 G A 6: 41,949,458 (GRCm39) V99I probably benign Het
Syna A G 5: 134,588,574 (GRCm39) I125T possibly damaging Het
Syne2 T C 12: 76,150,604 (GRCm39) S1827P probably damaging Het
Taf4b T C 18: 14,916,749 (GRCm39) V33A possibly damaging Het
Tpcn2 C T 7: 144,820,359 (GRCm39) R373H possibly damaging Het
Trpm1 A G 7: 63,918,541 (GRCm39) D1511G possibly damaging Het
Ttc3 C A 16: 94,219,535 (GRCm39) R487S probably damaging Het
Tubb3 T C 8: 124,147,594 (GRCm39) S176P possibly damaging Het
Zfp189 C G 4: 49,530,180 (GRCm39) Q428E probably benign Het
Zscan4d C T 7: 10,799,942 (GRCm39) V316M probably benign Het
Other mutations in Fbxw13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02033:Fbxw13 APN 9 109,010,484 (GRCm39) missense probably damaging 0.99
IGL02455:Fbxw13 APN 9 109,012,255 (GRCm39) missense probably benign 0.26
IGL03154:Fbxw13 APN 9 109,010,533 (GRCm39) missense probably damaging 0.96
R0304:Fbxw13 UTSW 9 109,023,789 (GRCm39) missense probably benign 0.02
R1259:Fbxw13 UTSW 9 109,014,439 (GRCm39) missense probably damaging 1.00
R1710:Fbxw13 UTSW 9 109,010,586 (GRCm39) missense probably damaging 1.00
R1912:Fbxw13 UTSW 9 109,010,611 (GRCm39) missense probably benign 0.10
R2877:Fbxw13 UTSW 9 109,010,534 (GRCm39) missense probably damaging 1.00
R2878:Fbxw13 UTSW 9 109,010,534 (GRCm39) missense probably damaging 1.00
R3085:Fbxw13 UTSW 9 109,013,299 (GRCm39) nonsense probably null
R4321:Fbxw13 UTSW 9 109,010,503 (GRCm39) missense probably benign 0.10
R4969:Fbxw13 UTSW 9 109,010,592 (GRCm39) splice site probably null
R5024:Fbxw13 UTSW 9 109,008,403 (GRCm39) missense probably benign 0.00
R5450:Fbxw13 UTSW 9 109,013,225 (GRCm39) missense probably benign 0.41
R5957:Fbxw13 UTSW 9 109,021,734 (GRCm39) critical splice donor site probably null
R6801:Fbxw13 UTSW 9 109,023,795 (GRCm39) missense probably null 1.00
R7448:Fbxw13 UTSW 9 109,014,471 (GRCm39) missense unknown
R7710:Fbxw13 UTSW 9 109,024,968 (GRCm39) missense probably damaging 1.00
R8163:Fbxw13 UTSW 9 109,012,122 (GRCm39) missense probably benign 0.45
R8714:Fbxw13 UTSW 9 109,023,832 (GRCm39) missense probably benign 0.00
R8845:Fbxw13 UTSW 9 109,023,833 (GRCm39) missense possibly damaging 0.85
R8884:Fbxw13 UTSW 9 109,010,469 (GRCm39) missense probably benign 0.00
R8979:Fbxw13 UTSW 9 109,013,197 (GRCm39) missense probably damaging 0.96
R9223:Fbxw13 UTSW 9 109,024,116 (GRCm39) missense probably damaging 1.00
R9318:Fbxw13 UTSW 9 109,008,382 (GRCm39) missense probably benign 0.17
X0065:Fbxw13 UTSW 9 109,021,776 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GCACATGCTAAACTATCTTTTCAGC -3'
(R):5'- TGAAAGCCCCTCATGTGGAG -3'

Sequencing Primer
(F):5'- GCTCCATCTTTCTGTTTGTGAGACAG -3'
(R):5'- GCCAGGCTGCAGAGATTTTCTC -3'
Posted On 2020-07-28