Incidental Mutation 'R8320:Stx7'
ID641918
Institutional Source Beutler Lab
Gene Symbol Stx7
Ensembl Gene ENSMUSG00000019998
Gene Namesyntaxin 7
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8320 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location24149302-24190222 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 24179148 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 63 (A63S)
Ref Sequence ENSEMBL: ENSMUSP00000020174 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020174]
Predicted Effect probably damaging
Transcript: ENSMUST00000020174
AA Change: A63S

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000020174
Gene: ENSMUSG00000019998
AA Change: A63S

DomainStartEndE-ValueType
SynN 3 116 2.66e-31 SMART
t_SNARE 160 227 2.39e-17 SMART
transmembrane domain 237 259 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a syntaxin family membrane receptor involved in vesicle transport. The encoded protein binds alpha-SNAP, an important regulator of transport vesicle fusion. Along with syntaxin 13, this protein plays a role in the ordered fusion of endosomes and lysosomes with the phagosome. [provided by RefSeq, May 2016]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asb10 A G 5: 24,537,628 probably null Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Clec3a T C 8: 114,425,629 V125A probably benign Het
Clspn A G 4: 126,563,950 D258G possibly damaging Het
Cnn3 T G 3: 121,449,986 L32R probably damaging Het
Cntnap5a T C 1: 116,446,736 F993L possibly damaging Het
Cobl A G 11: 12,267,001 S496P probably damaging Het
Dmxl2 A G 9: 54,383,759 V2469A probably benign Het
Dpcr1 T C 17: 35,643,638 T11A probably benign Het
Egfr T C 11: 16,891,251 F714S probably damaging Het
Erap1 G C 13: 74,666,549 E465Q probably benign Het
Ercc6 T C 14: 32,521,015 V204A probably benign Het
Fbln2 C T 6: 91,257,767 T689I possibly damaging Het
Fbxw13 G T 9: 109,183,066 T311K probably benign Het
Foxj2 T A 6: 122,833,690 S210T probably benign Het
Gnl1 A G 17: 35,982,598 N225S probably damaging Het
Grid2 T C 6: 63,256,933 I26T probably benign Het
Gzmd A G 14: 56,129,733 I234T probably benign Het
Igkv2-137 GA GAA 6: 67,556,170 probably null Het
Kif26b T C 1: 178,884,076 probably null Het
Klk1b1 C T 7: 43,970,343 R109C possibly damaging Het
Klra10 A G 6: 130,269,248 C255R probably damaging Het
Lgi4 T C 7: 31,068,941 V455A probably benign Het
Neb C A 2: 52,296,331 V910L probably benign Het
Pigg G A 5: 108,347,851 R918H probably benign Het
Poln A G 5: 34,149,827 V10A possibly damaging Het
Polr1a T A 6: 71,941,384 M642K probably damaging Het
Rasal1 C T 5: 120,666,355 R431C probably benign Het
Rfc1 A T 5: 65,303,036 Y167* probably null Het
Rnf17 TG T 14: 56,424,542 probably null Het
Sars2 C T 7: 28,746,868 T174I probably damaging Het
Sept4 T C 11: 87,589,734 V398A possibly damaging Het
Slc6a2 C T 8: 92,992,848 T397I probably benign Het
Smarca4 G T 9: 21,677,502 R1200L probably benign Het
Sval3 G A 6: 41,972,524 V99I probably benign Het
Syna A G 5: 134,559,720 I125T possibly damaging Het
Syne2 T C 12: 76,103,830 S1827P probably damaging Het
Taf4b T C 18: 14,783,692 V33A possibly damaging Het
Tpcn2 C T 7: 145,266,622 R373H possibly damaging Het
Trpm1 A G 7: 64,268,793 D1511G possibly damaging Het
Ttc3 C A 16: 94,418,676 R487S probably damaging Het
Tubb3 T C 8: 123,420,855 S176P possibly damaging Het
Zfp189 C G 4: 49,530,180 Q428E probably benign Het
Zscan4d C T 7: 11,066,015 V316M probably benign Het
Other mutations in Stx7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02959:Stx7 APN 10 24155349 missense probably benign 0.05
IGL03133:Stx7 APN 10 24185038 missense probably damaging 0.99
madison UTSW 10 24182761 splice site probably null
stones UTSW 10 24184985 critical splice acceptor site probably null
teufel UTSW 10 24181556 missense possibly damaging 0.86
R0201:Stx7 UTSW 10 24185079 splice site probably benign
R0413:Stx7 UTSW 10 24181594 missense probably damaging 0.99
R1624:Stx7 UTSW 10 24185005 missense probably damaging 1.00
R3980:Stx7 UTSW 10 24185049 missense probably damaging 0.99
R5874:Stx7 UTSW 10 24182761 splice site probably null
R6114:Stx7 UTSW 10 24184985 critical splice acceptor site probably null
R6493:Stx7 UTSW 10 24185071 critical splice donor site probably null
R8560:Stx7 UTSW 10 24181556 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- TGCAACCATTTACCAGGGTTG -3'
(R):5'- TGGAAGCACATGATACTACCTGAAC -3'

Sequencing Primer
(F):5'- CCAGGGTTGGTACAGGTGG -3'
(R):5'- CCCAGTTCAAAGATCCGA -3'
Posted On2020-07-28