Incidental Mutation 'R8320:Ercc6'
ID641924
Institutional Source Beutler Lab
Gene Symbol Ercc6
Ensembl Gene ENSMUSG00000054051
Gene Nameexcision repair cross-complementing rodent repair deficiency, complementation group 6
SynonymsCS group B correcting gene, C130058G22Rik, CSB
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.511) question?
Stock #R8320 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location32513521-32580990 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32521015 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 204 (V204A)
Ref Sequence ENSEMBL: ENSMUSP00000066256 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066807]
Predicted Effect probably benign
Transcript: ENSMUST00000066807
AA Change: V204A

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000066256
Gene: ENSMUSG00000054051
AA Change: V204A

DomainStartEndE-ValueType
PDB:4CVO|A 82 160 1e-36 PDB
low complexity region 286 299 N/A INTRINSIC
low complexity region 361 390 N/A INTRINSIC
low complexity region 422 434 N/A INTRINSIC
low complexity region 460 469 N/A INTRINSIC
low complexity region 479 491 N/A INTRINSIC
DEXDc 499 699 8.34e-33 SMART
Blast:DEXDc 720 821 7e-56 BLAST
HELICc 865 948 1.41e-21 SMART
low complexity region 1364 1377 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA-binding protein that is important in transcription-coupled excision repair. The encoded protein has ATP-stimulated ATPase activity, interacts with several transcription and excision repair proteins, and may promote complex formation at DNA repair sites. Mutations in this gene are associated with Cockayne syndrome type B and cerebrooculofacioskeletal syndrome 1. Alternative splicing occurs between a splice site from exon 5 of this gene to the 3' splice site upstream of the open reading frame (ORF) of the adjacent gene, piggyback-derived-3 (GeneID:267004), which activates the alternative polyadenylation site downstream of the piggyback-derived-3 ORF. The resulting transcripts encode a fusion protein that shares sequence with the product of each individual gene. [provided by RefSeq, Mar 2016]
PHENOTYPE: Homozygous mutant mice exhibit UV sensitivity, inactivation of transcription-coupled repair, increased incidence of induced skin and eye tumors, circling behavior, impaired coordination and lower body weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asb10 A G 5: 24,537,628 probably null Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Clec3a T C 8: 114,425,629 V125A probably benign Het
Clspn A G 4: 126,563,950 D258G possibly damaging Het
Cnn3 T G 3: 121,449,986 L32R probably damaging Het
Cntnap5a T C 1: 116,446,736 F993L possibly damaging Het
Cobl A G 11: 12,267,001 S496P probably damaging Het
Dmxl2 A G 9: 54,383,759 V2469A probably benign Het
Dpcr1 T C 17: 35,643,638 T11A probably benign Het
Egfr T C 11: 16,891,251 F714S probably damaging Het
Erap1 G C 13: 74,666,549 E465Q probably benign Het
Fbln2 C T 6: 91,257,767 T689I possibly damaging Het
Fbxw13 G T 9: 109,183,066 T311K probably benign Het
Foxj2 T A 6: 122,833,690 S210T probably benign Het
Gnl1 A G 17: 35,982,598 N225S probably damaging Het
Grid2 T C 6: 63,256,933 I26T probably benign Het
Gzmd A G 14: 56,129,733 I234T probably benign Het
Igkv2-137 GA GAA 6: 67,556,170 probably null Het
Kif26b T C 1: 178,884,076 probably null Het
Klk1b1 C T 7: 43,970,343 R109C possibly damaging Het
Klra10 A G 6: 130,269,248 C255R probably damaging Het
Lgi4 T C 7: 31,068,941 V455A probably benign Het
Neb C A 2: 52,296,331 V910L probably benign Het
Pigg G A 5: 108,347,851 R918H probably benign Het
Poln A G 5: 34,149,827 V10A possibly damaging Het
Polr1a T A 6: 71,941,384 M642K probably damaging Het
Rasal1 C T 5: 120,666,355 R431C probably benign Het
Rfc1 A T 5: 65,303,036 Y167* probably null Het
Rnf17 TG T 14: 56,424,542 probably null Het
Sars2 C T 7: 28,746,868 T174I probably damaging Het
Sept4 T C 11: 87,589,734 V398A possibly damaging Het
Slc6a2 C T 8: 92,992,848 T397I probably benign Het
Smarca4 G T 9: 21,677,502 R1200L probably benign Het
Stx7 G T 10: 24,179,148 A63S probably damaging Het
Sval3 G A 6: 41,972,524 V99I probably benign Het
Syna A G 5: 134,559,720 I125T possibly damaging Het
Syne2 T C 12: 76,103,830 S1827P probably damaging Het
Taf4b T C 18: 14,783,692 V33A possibly damaging Het
Tpcn2 C T 7: 145,266,622 R373H possibly damaging Het
Trpm1 A G 7: 64,268,793 D1511G possibly damaging Het
Ttc3 C A 16: 94,418,676 R487S probably damaging Het
Tubb3 T C 8: 123,420,855 S176P possibly damaging Het
Zfp189 C G 4: 49,530,180 Q428E probably benign Het
Zscan4d C T 7: 11,066,015 V316M probably benign Het
Other mutations in Ercc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Ercc6 APN 14 32568072 missense probably damaging 1.00
IGL00796:Ercc6 APN 14 32570002 missense probably benign 0.01
IGL00916:Ercc6 APN 14 32562655 intron probably benign
IGL01743:Ercc6 APN 14 32552604 missense probably damaging 1.00
IGL01802:Ercc6 APN 14 32562574 missense probably damaging 0.99
IGL01886:Ercc6 APN 14 32569580 missense possibly damaging 0.90
IGL02100:Ercc6 APN 14 32517095 missense probably benign 0.00
IGL02115:Ercc6 APN 14 32576993 missense probably damaging 1.00
IGL02755:Ercc6 APN 14 32575748 splice site probably benign
IGL02964:Ercc6 APN 14 32570103 missense probably benign 0.00
IGL02998:Ercc6 APN 14 32557857 missense probably benign 0.05
IGL03150:Ercc6 APN 14 32558574 missense probably damaging 0.96
R0152:Ercc6 UTSW 14 32546905 critical splice donor site probably benign
R0519:Ercc6 UTSW 14 32526842 missense probably damaging 1.00
R0591:Ercc6 UTSW 14 32558016 splice site probably benign
R0894:Ercc6 UTSW 14 32517028 missense probably benign 0.05
R0946:Ercc6 UTSW 14 32552621 missense probably benign 0.08
R1313:Ercc6 UTSW 14 32552720 splice site probably benign
R1506:Ercc6 UTSW 14 32569864 missense probably benign 0.01
R1528:Ercc6 UTSW 14 32519022 missense probably damaging 0.98
R1711:Ercc6 UTSW 14 32526176 missense probably damaging 1.00
R1753:Ercc6 UTSW 14 32576999 missense probably benign
R1795:Ercc6 UTSW 14 32517028 missense probably benign 0.05
R1843:Ercc6 UTSW 14 32546820 missense probably damaging 0.99
R1853:Ercc6 UTSW 14 32576816 missense possibly damaging 0.86
R1859:Ercc6 UTSW 14 32526778 missense probably damaging 1.00
R1912:Ercc6 UTSW 14 32576803 missense probably damaging 1.00
R2308:Ercc6 UTSW 14 32566409 missense possibly damaging 0.70
R2322:Ercc6 UTSW 14 32526317 missense probably damaging 1.00
R2386:Ercc6 UTSW 14 32541359 splice site probably null
R4170:Ercc6 UTSW 14 32566797 missense probably damaging 1.00
R4369:Ercc6 UTSW 14 32517207 missense probably damaging 0.96
R4389:Ercc6 UTSW 14 32574908 nonsense probably null
R4747:Ercc6 UTSW 14 32569907 missense probably benign 0.00
R4811:Ercc6 UTSW 14 32574929 missense probably benign 0.20
R4840:Ercc6 UTSW 14 32541296 missense probably damaging 1.00
R4973:Ercc6 UTSW 14 32574902 missense probably damaging 1.00
R5068:Ercc6 UTSW 14 32570063 missense probably benign 0.01
R5069:Ercc6 UTSW 14 32570063 missense probably benign 0.01
R5070:Ercc6 UTSW 14 32570063 missense probably benign 0.01
R5093:Ercc6 UTSW 14 32567522 missense probably damaging 1.00
R5265:Ercc6 UTSW 14 32569623 missense probably benign 0.01
R5272:Ercc6 UTSW 14 32519028 nonsense probably null
R5499:Ercc6 UTSW 14 32516959 start codon destroyed probably null 0.98
R5795:Ercc6 UTSW 14 32526352 missense probably damaging 0.98
R6258:Ercc6 UTSW 14 32557856 missense probably benign 0.00
R6260:Ercc6 UTSW 14 32557856 missense probably benign 0.00
R6267:Ercc6 UTSW 14 32526403 nonsense probably null
R6291:Ercc6 UTSW 14 32569986 missense probably benign 0.01
R6296:Ercc6 UTSW 14 32526403 nonsense probably null
R6361:Ercc6 UTSW 14 32517110 missense probably benign 0.00
R6500:Ercc6 UTSW 14 32526823 missense probably damaging 0.96
R6555:Ercc6 UTSW 14 32517107 missense probably benign 0.15
R6724:Ercc6 UTSW 14 32566331 missense probably benign 0.01
R6925:Ercc6 UTSW 14 32562608 missense probably damaging 0.99
R7143:Ercc6 UTSW 14 32570305 missense probably damaging 1.00
R7327:Ercc6 UTSW 14 32526404 missense probably benign 0.19
R7396:Ercc6 UTSW 14 32569805 missense probably benign 0.00
R7529:Ercc6 UTSW 14 32560729 nonsense probably null
R7609:Ercc6 UTSW 14 32566361 missense probably benign 0.11
R7802:Ercc6 UTSW 14 32517303 missense probably damaging 1.00
R7854:Ercc6 UTSW 14 32566292 missense probably damaging 1.00
R7995:Ercc6 UTSW 14 32562569 missense probably damaging 0.99
R8181:Ercc6 UTSW 14 32557948 missense probably damaging 1.00
R8388:Ercc6 UTSW 14 32570340 utr 3 prime probably benign
R8479:Ercc6 UTSW 14 32526406 missense probably benign 0.00
R8831:Ercc6 UTSW 14 32560827 critical splice donor site probably null
R8849:Ercc6 UTSW 14 32569608 missense probably damaging 1.00
R8912:Ercc6 UTSW 14 32526254 missense probably benign 0.40
Z1176:Ercc6 UTSW 14 32526487 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- CACTAGGGATGGTACCATGTGG -3'
(R):5'- TTAAGAGCTCTGATTCCGCAG -3'

Sequencing Primer
(F):5'- ACCATGTGGGCTTTTTGTTTACTC -3'
(R):5'- ATAAGATTTCCCCAGACCCATC -3'
Posted On2020-07-28