Mutagenetix > Incidental Mutation

Incidental Mutation 'R8320:Ercc6'

641924

Institutional Source

Beutler Lab

Gene Symbol

Ercc6

Ensembl Gene

ENSMUSG00000054051

Gene Name

excision repair cross-complementing rodent repair deficiency, complementation group 6

Synonyms

CS group B correcting gene, C130058G22Rik, CSB

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.495) question?

Stock #

R8320 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

32513521-32580990 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 32521015 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 204 (V204A)

Ref Sequence

ENSEMBL: ENSMUSP00000066256 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000066807]

AlphaFold

F8VPZ5

Predicted Effect

probably benign
Transcript: ENSMUST00000066807
AA Change: V204A

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000066256
Gene: ENSMUSG00000054051
AA Change: V204A

Domain	Start	End	E-Value	Type
PDB:4CVO\|A	82	160	1e-36	PDB
low complexity region	286	299	N/A	INTRINSIC
low complexity region	361	390	N/A	INTRINSIC
low complexity region	422	434	N/A	INTRINSIC
low complexity region	460	469	N/A	INTRINSIC
low complexity region	479	491	N/A	INTRINSIC
DEXDc	499	699	8.34e-33	SMART
Blast:DEXDc	720	821	7e-56	BLAST
HELICc	865	948	1.41e-21	SMART
low complexity region	1364	1377	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA-binding protein that is important in transcription-coupled excision repair. The encoded protein has ATP-stimulated ATPase activity, interacts with several transcription and excision repair proteins, and may promote complex formation at DNA repair sites. Mutations in this gene are associated with Cockayne syndrome type B and cerebrooculofacioskeletal syndrome 1. Alternative splicing occurs between a splice site from exon 5 of this gene to the 3' splice site upstream of the open reading frame (ORF) of the adjacent gene, piggyback-derived-3 (GeneID:267004), which activates the alternative polyadenylation site downstream of the piggyback-derived-3 ORF. The resulting transcripts encode a fusion protein that shares sequence with the product of each individual gene. [provided by RefSeq, Mar 2016]
PHENOTYPE: Homozygous mutant mice exhibit UV sensitivity, inactivation of transcription-coupled repair, increased incidence of induced skin and eye tumors, circling behavior, impaired coordination and lower body weight. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Asb10	A	G	5: 24,537,628		probably null	Het
Bhlhe40	TG	TGG	6: 108,664,857	254	probably null	Het
Clec3a	T	C	8: 114,425,629	V125A	probably benign	Het
Clspn	A	G	4: 126,563,950	D258G	possibly damaging	Het
Cnn3	T	G	3: 121,449,986	L32R	probably damaging	Het
Cntnap5a	T	C	1: 116,446,736	F993L	possibly damaging	Het
Cobl	A	G	11: 12,267,001	S496P	probably damaging	Het
Dmxl2	A	G	9: 54,383,759	V2469A	probably benign	Het
Dpcr1	T	C	17: 35,643,638	T11A	probably benign	Het
Egfr	T	C	11: 16,891,251	F714S	probably damaging	Het
Erap1	G	C	13: 74,666,549	E465Q	probably benign	Het
Fbln2	C	T	6: 91,257,767	T689I	possibly damaging	Het
Fbxw13	G	T	9: 109,183,066	T311K	probably benign	Het
Foxj2	T	A	6: 122,833,690	S210T	probably benign	Het
Gnl1	A	G	17: 35,982,598	N225S	probably damaging	Het
Grid2	T	C	6: 63,256,933	I26T	probably benign	Het
Gzmd	A	G	14: 56,129,733	I234T	probably benign	Het
Igkv2-137	GA	GAA	6: 67,556,170		probably null	Het
Kif26b	T	C	1: 178,884,076		probably null	Het
Klk1b1	C	T	7: 43,970,343	R109C	possibly damaging	Het
Klra10	A	G	6: 130,269,248	C255R	probably damaging	Het
Lgi4	T	C	7: 31,068,941	V455A	probably benign	Het
Neb	C	A	2: 52,296,331	V910L	probably benign	Het
Pigg	G	A	5: 108,347,851	R918H	probably benign	Het
Poln	A	G	5: 34,149,827	V10A	possibly damaging	Het
Polr1a	T	A	6: 71,941,384	M642K	probably damaging	Het
Rasal1	C	T	5: 120,666,355	R431C	probably benign	Het
Rfc1	A	T	5: 65,303,036	Y167*	probably null	Het
Rnf17	TG	T	14: 56,424,542	132	probably null	Het
Sars2	C	T	7: 28,746,868	T174I	probably damaging	Het
Sept4	T	C	11: 87,589,734	V398A	possibly damaging	Het
Slc6a2	C	T	8: 92,992,848	T397I	probably benign	Het
Smarca4	G	T	9: 21,677,502	R1200L	probably benign	Het
Stx7	G	T	10: 24,179,148	A63S	probably damaging	Het
Sval3	G	A	6: 41,972,524	V99I	probably benign	Het
Syna	A	G	5: 134,559,720	I125T	possibly damaging	Het
Syne2	T	C	12: 76,103,830	S1827P	probably damaging	Het
Taf4b	T	C	18: 14,783,692	V33A	possibly damaging	Het
Tpcn2	C	T	7: 145,266,622	R373H	possibly damaging	Het
Trpm1	A	G	7: 64,268,793	D1511G	possibly damaging	Het
Ttc3	C	A	16: 94,418,676	R487S	probably damaging	Het
Tubb3	T	C	8: 123,420,855	S176P	possibly damaging	Het
Zfp189	C	G	4: 49,530,180	Q428E	probably benign	Het
Zscan4d	C	T	7: 11,066,015	V316M	probably benign	Het

Other mutations in Ercc6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00321:Ercc6	APN	14	32568072	missense	probably damaging	1.00
IGL00796:Ercc6	APN	14	32570002	missense	probably benign	0.01
IGL00916:Ercc6	APN	14	32562655	intron	probably benign
IGL01743:Ercc6	APN	14	32552604	missense	probably damaging	1.00
IGL01802:Ercc6	APN	14	32562574	missense	probably damaging	0.99
IGL01886:Ercc6	APN	14	32569580	missense	possibly damaging	0.90
IGL02100:Ercc6	APN	14	32517095	missense	probably benign	0.00
IGL02115:Ercc6	APN	14	32576993	missense	probably damaging	1.00
IGL02755:Ercc6	APN	14	32575748	splice site	probably benign
IGL02964:Ercc6	APN	14	32570103	missense	probably benign	0.00
IGL02998:Ercc6	APN	14	32557857	missense	probably benign	0.05
IGL03150:Ercc6	APN	14	32558574	missense	probably damaging	0.96
R0152:Ercc6	UTSW	14	32546905	critical splice donor site	probably benign
R0519:Ercc6	UTSW	14	32526842	missense	probably damaging	1.00
R0591:Ercc6	UTSW	14	32558016	splice site	probably benign
R0894:Ercc6	UTSW	14	32517028	missense	probably benign	0.05
R0946:Ercc6	UTSW	14	32552621	missense	probably benign	0.08
R1313:Ercc6	UTSW	14	32552720	splice site	probably benign
R1506:Ercc6	UTSW	14	32569864	missense	probably benign	0.01
R1528:Ercc6	UTSW	14	32519022	missense	probably damaging	0.98
R1711:Ercc6	UTSW	14	32526176	missense	probably damaging	1.00
R1753:Ercc6	UTSW	14	32576999	missense	probably benign
R1795:Ercc6	UTSW	14	32517028	missense	probably benign	0.05
R1843:Ercc6	UTSW	14	32546820	missense	probably damaging	0.99
R1853:Ercc6	UTSW	14	32576816	missense	possibly damaging	0.86
R1859:Ercc6	UTSW	14	32526778	missense	probably damaging	1.00
R1912:Ercc6	UTSW	14	32576803	missense	probably damaging	1.00
R2308:Ercc6	UTSW	14	32566409	missense	possibly damaging	0.70
R2322:Ercc6	UTSW	14	32526317	missense	probably damaging	1.00
R2386:Ercc6	UTSW	14	32541359	splice site	probably null
R4170:Ercc6	UTSW	14	32566797	missense	probably damaging	1.00
R4369:Ercc6	UTSW	14	32517207	missense	probably damaging	0.96
R4389:Ercc6	UTSW	14	32574908	nonsense	probably null
R4747:Ercc6	UTSW	14	32569907	missense	probably benign	0.00
R4811:Ercc6	UTSW	14	32574929	missense	probably benign	0.20
R4840:Ercc6	UTSW	14	32541296	missense	probably damaging	1.00
R4973:Ercc6	UTSW	14	32574902	missense	probably damaging	1.00
R5068:Ercc6	UTSW	14	32570063	missense	probably benign	0.01
R5069:Ercc6	UTSW	14	32570063	missense	probably benign	0.01
R5070:Ercc6	UTSW	14	32570063	missense	probably benign	0.01
R5093:Ercc6	UTSW	14	32567522	missense	probably damaging	1.00
R5265:Ercc6	UTSW	14	32569623	missense	probably benign	0.01
R5272:Ercc6	UTSW	14	32519028	nonsense	probably null
R5499:Ercc6	UTSW	14	32516959	start codon destroyed	probably null	0.98
R5795:Ercc6	UTSW	14	32526352	missense	probably damaging	0.98
R6258:Ercc6	UTSW	14	32557856	missense	probably benign	0.00
R6260:Ercc6	UTSW	14	32557856	missense	probably benign	0.00
R6267:Ercc6	UTSW	14	32526403	nonsense	probably null
R6291:Ercc6	UTSW	14	32569986	missense	probably benign	0.01
R6296:Ercc6	UTSW	14	32526403	nonsense	probably null
R6361:Ercc6	UTSW	14	32517110	missense	probably benign	0.00
R6500:Ercc6	UTSW	14	32526823	missense	probably damaging	0.96
R6555:Ercc6	UTSW	14	32517107	missense	probably benign	0.15
R6724:Ercc6	UTSW	14	32566331	missense	probably benign	0.01
R6925:Ercc6	UTSW	14	32562608	missense	probably damaging	0.99
R7143:Ercc6	UTSW	14	32570305	missense	probably damaging	1.00
R7327:Ercc6	UTSW	14	32526404	missense	probably benign	0.19
R7396:Ercc6	UTSW	14	32569805	missense	probably benign	0.00
R7529:Ercc6	UTSW	14	32560729	nonsense	probably null
R7609:Ercc6	UTSW	14	32566361	missense	probably benign	0.11
R7802:Ercc6	UTSW	14	32517303	missense	probably damaging	1.00
R7854:Ercc6	UTSW	14	32566292	missense	probably damaging	1.00
R7995:Ercc6	UTSW	14	32562569	missense	probably damaging	0.99
R8181:Ercc6	UTSW	14	32557948	missense	probably damaging	1.00
R8388:Ercc6	UTSW	14	32570340	utr 3 prime	probably benign
R8479:Ercc6	UTSW	14	32526406	missense	probably benign	0.00
R8831:Ercc6	UTSW	14	32560827	critical splice donor site	probably null
R8849:Ercc6	UTSW	14	32569608	missense	probably damaging	1.00
R8912:Ercc6	UTSW	14	32526254	missense	probably benign	0.40
R9210:Ercc6	UTSW	14	32569865	missense	probably benign	0.00
R9309:Ercc6	UTSW	14	32518947	missense	probably damaging	1.00
R9499:Ercc6	UTSW	14	32562568	missense	probably damaging	1.00
R9552:Ercc6	UTSW	14	32562568	missense	probably damaging	1.00
R9562:Ercc6	UTSW	14	32574967	missense	probably damaging	1.00
R9688:Ercc6	UTSW	14	32575798	missense	probably benign
R9699:Ercc6	UTSW	14	32560746	missense	probably damaging	1.00
R9743:Ercc6	UTSW	14	32576986	missense	probably benign	0.01
Z1176:Ercc6	UTSW	14	32526487	missense	probably benign	0.27

Predicted Primers

PCR Primer
(F):5'- CACTAGGGATGGTACCATGTGG -3'
(R):5'- TTAAGAGCTCTGATTCCGCAG -3'

Sequencing Primer
(F):5'- ACCATGTGGGCTTTTTGTTTACTC -3'
(R):5'- ATAAGATTTCCCCAGACCCATC -3'

Posted On

2020-07-28