Incidental Mutation 'R8320:Ttc3'
ID641927
Institutional Source Beutler Lab
Gene Symbol Ttc3
Ensembl Gene ENSMUSG00000040785
Gene Nametetratricopeptide repeat domain 3
Synonyms2610202A04Rik, D16Ium21, D16Ium21e, TPRD
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.621) question?
Stock #R8320 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location94370618-94469343 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 94418676 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 487 (R487S)
Ref Sequence ENSEMBL: ENSMUSP00000116097 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117648] [ENSMUST00000122895] [ENSMUST00000139513] [ENSMUST00000141856] [ENSMUST00000143145] [ENSMUST00000145883] [ENSMUST00000147046] [ENSMUST00000147352] [ENSMUST00000150097] [ENSMUST00000150346] [ENSMUST00000151770] [ENSMUST00000152117] [ENSMUST00000153988] [ENSMUST00000155692]
Predicted Effect probably damaging
Transcript: ENSMUST00000117648
AA Change: R505S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112801
Gene: ENSMUSG00000040785
AA Change: R505S

DomainStartEndE-ValueType
TPR 231 264 3.61e-2 SMART
TPR 265 298 3.32e-1 SMART
Blast:TPR 300 332 2e-12 BLAST
low complexity region 444 459 N/A INTRINSIC
TPR 576 609 2.55e-2 SMART
low complexity region 720 732 N/A INTRINSIC
coiled coil region 765 796 N/A INTRINSIC
low complexity region 1018 1032 N/A INTRINSIC
low complexity region 1036 1050 N/A INTRINSIC
low complexity region 1170 1190 N/A INTRINSIC
low complexity region 1248 1260 N/A INTRINSIC
low complexity region 1278 1291 N/A INTRINSIC
coiled coil region 1472 1570 N/A INTRINSIC
low complexity region 1876 1887 N/A INTRINSIC
RING 1931 1970 7e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000122895
AA Change: R487S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000123037
Gene: ENSMUSG00000040785
AA Change: R487S

DomainStartEndE-ValueType
TPR 213 246 3.61e-2 SMART
TPR 247 280 3.32e-1 SMART
Blast:TPR 282 314 3e-12 BLAST
low complexity region 426 441 N/A INTRINSIC
TPR 558 591 2.55e-2 SMART
low complexity region 702 714 N/A INTRINSIC
coiled coil region 747 778 N/A INTRINSIC
low complexity region 1000 1014 N/A INTRINSIC
low complexity region 1018 1032 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139513
SMART Domains Protein: ENSMUSP00000117881
Gene: ENSMUSG00000040785

DomainStartEndE-ValueType
low complexity region 8 22 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000141856
AA Change: R19S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117369
Gene: ENSMUSG00000040785
AA Change: R19S

DomainStartEndE-ValueType
Pfam:TPR_1 90 121 1e-6 PFAM
Pfam:TPR_2 90 121 7.9e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143145
Predicted Effect probably damaging
Transcript: ENSMUST00000145883
AA Change: R19S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123442
Gene: ENSMUSG00000040785
AA Change: R19S

DomainStartEndE-ValueType
transmembrane domain 42 64 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000147046
AA Change: R104S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119265
Gene: ENSMUSG00000040785
AA Change: R104S

DomainStartEndE-ValueType
low complexity region 43 58 N/A INTRINSIC
Pfam:TPR_1 175 206 5.3e-6 PFAM
low complexity region 319 331 N/A INTRINSIC
low complexity region 359 382 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000147352
AA Change: R487S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116097
Gene: ENSMUSG00000040785
AA Change: R487S

DomainStartEndE-ValueType
TPR 213 246 3.61e-2 SMART
TPR 247 280 3.32e-1 SMART
Blast:TPR 282 314 3e-12 BLAST
low complexity region 426 441 N/A INTRINSIC
TPR 558 591 2.55e-2 SMART
low complexity region 702 714 N/A INTRINSIC
coiled coil region 747 778 N/A INTRINSIC
low complexity region 1000 1014 N/A INTRINSIC
low complexity region 1018 1032 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150097
SMART Domains Protein: ENSMUSP00000119035
Gene: ENSMUSG00000040785

DomainStartEndE-ValueType
Blast:TPR 1 22 1e-6 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000150346
AA Change: R104S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122726
Gene: ENSMUSG00000040785
AA Change: R104S

DomainStartEndE-ValueType
low complexity region 43 58 N/A INTRINSIC
Pfam:TPR_1 175 206 9.6e-6 PFAM
low complexity region 319 331 N/A INTRINSIC
coiled coil region 364 395 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000151770
AA Change: R505S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121349
Gene: ENSMUSG00000040785
AA Change: R505S

DomainStartEndE-ValueType
TPR 231 264 3.61e-2 SMART
TPR 265 298 3.32e-1 SMART
Blast:TPR 300 332 3e-12 BLAST
low complexity region 444 459 N/A INTRINSIC
TPR 576 609 2.55e-2 SMART
low complexity region 720 732 N/A INTRINSIC
coiled coil region 765 796 N/A INTRINSIC
low complexity region 1018 1032 N/A INTRINSIC
low complexity region 1036 1050 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000152117
AA Change: R104S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116896
Gene: ENSMUSG00000040785
AA Change: R104S

DomainStartEndE-ValueType
low complexity region 43 58 N/A INTRINSIC
SCOP:d1ihga1 69 201 6e-8 SMART
Blast:TPR 175 208 1e-14 BLAST
low complexity region 319 331 N/A INTRINSIC
coiled coil region 364 395 N/A INTRINSIC
low complexity region 617 631 N/A INTRINSIC
low complexity region 635 649 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000153988
AA Change: R195S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118763
Gene: ENSMUSG00000040785
AA Change: R195S

DomainStartEndE-ValueType
Blast:TPR 1 22 3e-6 BLAST
low complexity region 134 149 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000155692
AA Change: R524S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000122724
Gene: ENSMUSG00000040785
AA Change: R524S

DomainStartEndE-ValueType
TPR 250 283 3.61e-2 SMART
TPR 284 317 3.32e-1 SMART
Blast:TPR 319 351 3e-12 BLAST
low complexity region 463 478 N/A INTRINSIC
TPR 595 628 2.55e-2 SMART
low complexity region 739 751 N/A INTRINSIC
coiled coil region 784 815 N/A INTRINSIC
low complexity region 1037 1051 N/A INTRINSIC
low complexity region 1055 1069 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asb10 A G 5: 24,537,628 probably null Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Clec3a T C 8: 114,425,629 V125A probably benign Het
Clspn A G 4: 126,563,950 D258G possibly damaging Het
Cnn3 T G 3: 121,449,986 L32R probably damaging Het
Cntnap5a T C 1: 116,446,736 F993L possibly damaging Het
Cobl A G 11: 12,267,001 S496P probably damaging Het
Dmxl2 A G 9: 54,383,759 V2469A probably benign Het
Dpcr1 T C 17: 35,643,638 T11A probably benign Het
Egfr T C 11: 16,891,251 F714S probably damaging Het
Erap1 G C 13: 74,666,549 E465Q probably benign Het
Ercc6 T C 14: 32,521,015 V204A probably benign Het
Fbln2 C T 6: 91,257,767 T689I possibly damaging Het
Fbxw13 G T 9: 109,183,066 T311K probably benign Het
Foxj2 T A 6: 122,833,690 S210T probably benign Het
Gnl1 A G 17: 35,982,598 N225S probably damaging Het
Grid2 T C 6: 63,256,933 I26T probably benign Het
Gzmd A G 14: 56,129,733 I234T probably benign Het
Igkv2-137 GA GAA 6: 67,556,170 probably null Het
Kif26b T C 1: 178,884,076 probably null Het
Klk1b1 C T 7: 43,970,343 R109C possibly damaging Het
Klra10 A G 6: 130,269,248 C255R probably damaging Het
Lgi4 T C 7: 31,068,941 V455A probably benign Het
Neb C A 2: 52,296,331 V910L probably benign Het
Pigg G A 5: 108,347,851 R918H probably benign Het
Poln A G 5: 34,149,827 V10A possibly damaging Het
Polr1a T A 6: 71,941,384 M642K probably damaging Het
Rasal1 C T 5: 120,666,355 R431C probably benign Het
Rfc1 A T 5: 65,303,036 Y167* probably null Het
Rnf17 TG T 14: 56,424,542 probably null Het
Sars2 C T 7: 28,746,868 T174I probably damaging Het
Sept4 T C 11: 87,589,734 V398A possibly damaging Het
Slc6a2 C T 8: 92,992,848 T397I probably benign Het
Smarca4 G T 9: 21,677,502 R1200L probably benign Het
Stx7 G T 10: 24,179,148 A63S probably damaging Het
Sval3 G A 6: 41,972,524 V99I probably benign Het
Syna A G 5: 134,559,720 I125T possibly damaging Het
Syne2 T C 12: 76,103,830 S1827P probably damaging Het
Taf4b T C 18: 14,783,692 V33A possibly damaging Het
Tpcn2 C T 7: 145,266,622 R373H possibly damaging Het
Trpm1 A G 7: 64,268,793 D1511G possibly damaging Het
Tubb3 T C 8: 123,420,855 S176P possibly damaging Het
Zfp189 C G 4: 49,530,180 Q428E probably benign Het
Zscan4d C T 7: 11,066,015 V316M probably benign Het
Other mutations in Ttc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Ttc3 APN 16 94426761 splice site probably null
IGL00979:Ttc3 APN 16 94456718 missense probably damaging 1.00
IGL01520:Ttc3 APN 16 94390207 missense probably benign 0.04
IGL01663:Ttc3 APN 16 94409731 critical splice donor site probably null
IGL01720:Ttc3 APN 16 94385369 missense probably damaging 0.99
IGL01736:Ttc3 APN 16 94442527 missense probably damaging 0.99
IGL02045:Ttc3 APN 16 94409681 splice site probably benign
IGL02203:Ttc3 APN 16 94418598 splice site probably benign
IGL02327:Ttc3 APN 16 94448108 missense probably damaging 1.00
IGL02794:Ttc3 APN 16 94467926 missense probably damaging 1.00
IGL02898:Ttc3 APN 16 94419426 missense probably damaging 1.00
PIT4378001:Ttc3 UTSW 16 94410906 missense probably benign 0.01
R0064:Ttc3 UTSW 16 94422247 missense possibly damaging 0.79
R0098:Ttc3 UTSW 16 94390265 missense probably benign 0.02
R0112:Ttc3 UTSW 16 94385322 splice site probably benign
R0135:Ttc3 UTSW 16 94462268 missense possibly damaging 0.92
R0480:Ttc3 UTSW 16 94432004 nonsense probably null
R0513:Ttc3 UTSW 16 94426212 missense probably damaging 1.00
R0532:Ttc3 UTSW 16 94387330 splice site probably benign
R0607:Ttc3 UTSW 16 94456785 nonsense probably null
R0742:Ttc3 UTSW 16 94459880 missense probably benign 0.23
R0905:Ttc3 UTSW 16 94456789 nonsense probably null
R1118:Ttc3 UTSW 16 94416268 splice site probably benign
R1355:Ttc3 UTSW 16 94418637 missense possibly damaging 0.46
R1370:Ttc3 UTSW 16 94418637 missense possibly damaging 0.46
R1486:Ttc3 UTSW 16 94448129 missense probably damaging 1.00
R1598:Ttc3 UTSW 16 94422297 missense probably damaging 1.00
R1641:Ttc3 UTSW 16 94443317 missense probably benign 0.19
R2092:Ttc3 UTSW 16 94442832 missense probably benign 0.02
R2232:Ttc3 UTSW 16 94459972 missense probably benign 0.00
R2339:Ttc3 UTSW 16 94431998 missense probably damaging 1.00
R2342:Ttc3 UTSW 16 94431998 missense probably damaging 1.00
R2842:Ttc3 UTSW 16 94431998 missense probably damaging 1.00
R3117:Ttc3 UTSW 16 94442563 missense possibly damaging 0.51
R4194:Ttc3 UTSW 16 94422277 missense probably damaging 0.99
R4329:Ttc3 UTSW 16 94466961 missense probably damaging 1.00
R4431:Ttc3 UTSW 16 94410958 critical splice donor site probably null
R4530:Ttc3 UTSW 16 94466877 intron probably benign
R4531:Ttc3 UTSW 16 94466877 intron probably benign
R4532:Ttc3 UTSW 16 94466877 intron probably benign
R4533:Ttc3 UTSW 16 94466877 intron probably benign
R4588:Ttc3 UTSW 16 94442901 missense probably benign 0.01
R4625:Ttc3 UTSW 16 94388272 nonsense probably null
R4676:Ttc3 UTSW 16 94442761 missense probably damaging 1.00
R4700:Ttc3 UTSW 16 94439241 splice site probably null
R4856:Ttc3 UTSW 16 94390283 missense probably benign 0.32
R4867:Ttc3 UTSW 16 94454515 missense probably damaging 0.96
R4885:Ttc3 UTSW 16 94419465 missense probably damaging 1.00
R4885:Ttc3 UTSW 16 94426831 critical splice donor site probably null
R4899:Ttc3 UTSW 16 94429455 missense probably damaging 1.00
R4997:Ttc3 UTSW 16 94452982 missense probably damaging 1.00
R5023:Ttc3 UTSW 16 94429359 missense probably benign 0.01
R5105:Ttc3 UTSW 16 94466934 missense possibly damaging 0.94
R5205:Ttc3 UTSW 16 94448059 missense probably benign 0.07
R5287:Ttc3 UTSW 16 94459844 missense probably benign 0.00
R5338:Ttc3 UTSW 16 94384041 missense probably damaging 0.99
R5347:Ttc3 UTSW 16 94429620 missense probably damaging 1.00
R5403:Ttc3 UTSW 16 94459844 missense probably benign 0.00
R5460:Ttc3 UTSW 16 94457382 missense probably benign 0.32
R5739:Ttc3 UTSW 16 94439324 nonsense probably null
R6242:Ttc3 UTSW 16 94442695 missense probably benign 0.04
R6253:Ttc3 UTSW 16 94457413 critical splice donor site probably null
R6455:Ttc3 UTSW 16 94418623 start codon destroyed probably null 0.83
R6559:Ttc3 UTSW 16 94422349 critical splice donor site probably null
R6564:Ttc3 UTSW 16 94442611 missense probably damaging 1.00
R6932:Ttc3 UTSW 16 94443453 missense probably benign
R7331:Ttc3 UTSW 16 94394359 missense probably benign 0.27
R7497:Ttc3 UTSW 16 94418682 missense possibly damaging 0.93
R7610:Ttc3 UTSW 16 94427838 missense probably benign 0.11
R7738:Ttc3 UTSW 16 94387382 missense probably benign 0.00
R7970:Ttc3 UTSW 16 94457364 missense probably damaging 1.00
R8052:Ttc3 UTSW 16 94467989 missense probably benign 0.09
R8087:Ttc3 UTSW 16 94442953 missense probably benign 0.00
R8309:Ttc3 UTSW 16 94466979 missense probably damaging 1.00
R8322:Ttc3 UTSW 16 94454492 missense probably damaging 1.00
R8518:Ttc3 UTSW 16 94457379 missense probably benign 0.21
X0022:Ttc3 UTSW 16 94442525 missense probably benign 0.00
Y5378:Ttc3 UTSW 16 94412129 splice site probably null
Predicted Primers PCR Primer
(F):5'- TGACAGTTGCACCCACCTAC -3'
(R):5'- ACACAAACTGGGAGCACTACTTG -3'

Sequencing Primer
(F):5'- AGATACGGGTTTGGACTC -3'
(R):5'- CAGTTAGGAACAATGGATGCTCTACC -3'
Posted On2020-07-28