Mutagenetix > Incidental Mutations

Incidental Mutation 'R8320:Taf4b'

641930

Institutional Source

Beutler Lab

Gene Symbol

Taf4b

Ensembl Gene

ENSMUSG00000054321

Gene Name

TATA-box binding protein associated factor 4b

Synonyms

Taf2c2, TAFII105, 2610524B04Rik, 105kDa, 4932409F03Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.401) question?

Stock #

R8320 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

14783245-14900359 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 14783692 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 33 (V33A)

Ref Sequence

ENSEMBL: ENSMUSP00000126909 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000169862]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000169862
AA Change: V33A

PolyPhen 2 Score 0.581 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000126909
Gene: ENSMUSG00000054321
AA Change: V33A

Domain	Start	End	E-Value	Type
low complexity region	8	23	N/A	INTRINSIC
low complexity region	185	196	N/A	INTRINSIC
Pfam:TAFH	257	348	5.3e-39	PFAM
low complexity region	359	376	N/A	INTRINSIC
low complexity region	412	422	N/A	INTRINSIC
Pfam:TAF4	610	852	4e-72	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] TATA binding protein (TBP) and TBP-associated factors (TAFs) participate in the formation of the TFIID protein complex, which is involved in initiation of transcription of genes by RNA polymerase II. This gene encodes a cell type-specific TAF that may be responsible for mediating transcription by a subset of activators in B cells. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jun 2014]
PHENOTYPE: Homozygotes for a targeted null mutation are infertile due to a granulosa cell defect preventing normal follicle formation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Asb10	A	G	5: 24,537,628		probably null	Het
Bhlhe40	TG	TGG	6: 108,664,857	254	probably null	Het
Clec3a	T	C	8: 114,425,629	V125A	probably benign	Het
Clspn	A	G	4: 126,563,950	D258G	possibly damaging	Het
Cnn3	T	G	3: 121,449,986	L32R	probably damaging	Het
Cntnap5a	T	C	1: 116,446,736	F993L	possibly damaging	Het
Cobl	A	G	11: 12,267,001	S496P	probably damaging	Het
Dmxl2	A	G	9: 54,383,759	V2469A	probably benign	Het
Dpcr1	T	C	17: 35,643,638	T11A	probably benign	Het
Egfr	T	C	11: 16,891,251	F714S	probably damaging	Het
Erap1	G	C	13: 74,666,549	E465Q	probably benign	Het
Ercc6	T	C	14: 32,521,015	V204A	probably benign	Het
Fbln2	C	T	6: 91,257,767	T689I	possibly damaging	Het
Fbxw13	G	T	9: 109,183,066	T311K	probably benign	Het
Foxj2	T	A	6: 122,833,690	S210T	probably benign	Het
Gnl1	A	G	17: 35,982,598	N225S	probably damaging	Het
Grid2	T	C	6: 63,256,933	I26T	probably benign	Het
Gzmd	A	G	14: 56,129,733	I234T	probably benign	Het
Igkv2-137	GA	GAA	6: 67,556,170		probably null	Het
Kif26b	T	C	1: 178,884,076		probably null	Het
Klk1b1	C	T	7: 43,970,343	R109C	possibly damaging	Het
Klra10	A	G	6: 130,269,248	C255R	probably damaging	Het
Lgi4	T	C	7: 31,068,941	V455A	probably benign	Het
Neb	C	A	2: 52,296,331	V910L	probably benign	Het
Pigg	G	A	5: 108,347,851	R918H	probably benign	Het
Poln	A	G	5: 34,149,827	V10A	possibly damaging	Het
Polr1a	T	A	6: 71,941,384	M642K	probably damaging	Het
Rasal1	C	T	5: 120,666,355	R431C	probably benign	Het
Rfc1	A	T	5: 65,303,036	Y167*	probably null	Het
Rnf17	TG	T	14: 56,424,542	132	probably null	Het
Sars2	C	T	7: 28,746,868	T174I	probably damaging	Het
Sept4	T	C	11: 87,589,734	V398A	possibly damaging	Het
Slc6a2	C	T	8: 92,992,848	T397I	probably benign	Het
Smarca4	G	T	9: 21,677,502	R1200L	probably benign	Het
Stx7	G	T	10: 24,179,148	A63S	probably damaging	Het
Sval3	G	A	6: 41,972,524	V99I	probably benign	Het
Syna	A	G	5: 134,559,720	I125T	possibly damaging	Het
Syne2	T	C	12: 76,103,830	S1827P	probably damaging	Het
Tpcn2	C	T	7: 145,266,622	R373H	possibly damaging	Het
Trpm1	A	G	7: 64,268,793	D1511G	possibly damaging	Het
Ttc3	C	A	16: 94,418,676	R487S	probably damaging	Het
Tubb3	T	C	8: 123,420,855	S176P	possibly damaging	Het
Zfp189	C	G	4: 49,530,180	Q428E	probably benign	Het
Zscan4d	C	T	7: 11,066,015	V316M	probably benign	Het

Other mutations in Taf4b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01658:Taf4b	APN	18	14844420	missense	probably damaging	1.00
IGL01755:Taf4b	APN	18	14897985	missense	probably benign
IGL01755:Taf4b	APN	18	14897986	missense	probably benign	0.13
IGL02049:Taf4b	APN	18	14830139	missense	probably benign	0.00
IGL02650:Taf4b	APN	18	14841983	nonsense	probably null
IGL03078:Taf4b	APN	18	14813554	missense	possibly damaging	0.48
IGL03169:Taf4b	APN	18	14821535	missense	probably damaging	1.00
IGL03261:Taf4b	APN	18	14821528	missense	probably benign
adirondack	UTSW	18	14804578	missense	probably null	0.16
R0266:Taf4b	UTSW	18	14813077	splice site	probably benign
R0385:Taf4b	UTSW	18	14783760	missense	probably benign	0.00
R1015:Taf4b	UTSW	18	14813098	missense	probably damaging	1.00
R1054:Taf4b	UTSW	18	14821473	missense	probably benign	0.00
R1416:Taf4b	UTSW	18	14821427	splice site	probably benign
R1435:Taf4b	UTSW	18	14807409	missense	probably damaging	1.00
R1609:Taf4b	UTSW	18	14835881	missense	probably damaging	1.00
R1611:Taf4b	UTSW	18	14844469	missense	probably null	1.00
R1906:Taf4b	UTSW	18	14822102	missense	probably benign	0.00
R2038:Taf4b	UTSW	18	14807399	missense	probably damaging	1.00
R2890:Taf4b	UTSW	18	14804792	missense	probably damaging	1.00
R4527:Taf4b	UTSW	18	14821442	missense	probably damaging	1.00
R4559:Taf4b	UTSW	18	14813526	missense	probably damaging	1.00
R4773:Taf4b	UTSW	18	14804520	missense	probably benign	0.30
R4857:Taf4b	UTSW	18	14804578	missense	probably null	0.16
R4946:Taf4b	UTSW	18	14813542	missense	probably damaging	1.00
R4984:Taf4b	UTSW	18	14835816	missense	probably damaging	1.00
R4994:Taf4b	UTSW	18	14898043	missense	probably damaging	0.99
R5010:Taf4b	UTSW	18	14822172	missense	possibly damaging	0.59
R5155:Taf4b	UTSW	18	14830095	missense	probably benign	0.07
R5874:Taf4b	UTSW	18	14804554	missense	probably benign
R6079:Taf4b	UTSW	18	14822198	missense	possibly damaging	0.75
R6303:Taf4b	UTSW	18	14807355	missense	probably damaging	1.00
R6304:Taf4b	UTSW	18	14807355	missense	probably damaging	1.00
R6372:Taf4b	UTSW	18	14804733	missense	probably damaging	1.00
R6972:Taf4b	UTSW	18	14813347	missense	possibly damaging	0.86
R7538:Taf4b	UTSW	18	14813545	missense	probably damaging	1.00
R7790:Taf4b	UTSW	18	14813274	missense	probably damaging	1.00
R8021:Taf4b	UTSW	18	14804524	missense	probably damaging	1.00
R8072:Taf4b	UTSW	18	14821528	missense	probably benign
R8075:Taf4b	UTSW	18	14783692	missense	possibly damaging	0.58
R8145:Taf4b	UTSW	18	14830028	missense	probably damaging	1.00
R8221:Taf4b	UTSW	18	14898049	missense	probably damaging	1.00
R8509:Taf4b	UTSW	18	14898055	missense	probably damaging	1.00
R8535:Taf4b	UTSW	18	14822138	missense	probably damaging	0.99
R8772:Taf4b	UTSW	18	14835852	missense	probably damaging	1.00
R8805:Taf4b	UTSW	18	14813428	missense	possibly damaging	0.65
R8874:Taf4b	UTSW	18	14830070	missense	probably benign	0.39
R9155:Taf4b	UTSW	18	14813239	missense	probably benign	0.00
R9254:Taf4b	UTSW	18	14813374	missense	probably damaging	0.98
R9338:Taf4b	UTSW	18	14821498	missense	probably benign	0.00
R9379:Taf4b	UTSW	18	14813374	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- AAGCTCCGAGTTAAAGCTCC -3'
(R):5'- ACGGTGACTATCTGAGGAGC -3'

Sequencing Primer
(F):5'- AACTGAAGTGACGCCCTG -3'
(R):5'- CTATCTGAGGAGCGGGCAG -3'

Posted On

2020-07-28