Incidental Mutation 'R8321:Fastkd2'
ID 641931
Institutional Source Beutler Lab
Gene Symbol Fastkd2
Ensembl Gene ENSMUSG00000025962
Gene Name FAST kinase domains 2
Synonyms 2810421I24Rik
MMRRC Submission 067723-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8321 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 63769758-63792544 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 63787138 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 524 (H524R)
Ref Sequence ENSEMBL: ENSMUSP00000027103 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027103]
AlphaFold Q922E6
Predicted Effect probably benign
Transcript: ENSMUST00000027103
AA Change: H524R

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000027103
Gene: ENSMUSG00000025962
AA Change: H524R

DomainStartEndE-ValueType
low complexity region 310 323 N/A INTRINSIC
Pfam:FAST_1 443 512 2.3e-23 PFAM
low complexity region 546 557 N/A INTRINSIC
RAP 619 675 1.66e-16 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is localized in the mitochondrial inner compartment and that may play a role in mitochondrial apoptosis. Nonsense mutations have been reported to result in cytochrome c oxidase deficiency. [provided by RefSeq, Oct 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap44 A G 11: 64,899,053 (GRCm39) V708A probably benign Het
Atg9a G A 1: 75,162,342 (GRCm39) Q523* probably null Het
Bank1 T A 3: 135,940,395 (GRCm39) E329V possibly damaging Het
Ccdc162 C A 10: 41,510,029 (GRCm39) A859S probably damaging Het
Cdh11 T C 8: 103,361,416 (GRCm39) R641G probably damaging Het
Cfap58 A G 19: 47,946,586 (GRCm39) E373G probably damaging Het
Chd8 T C 14: 52,470,024 (GRCm39) T529A probably benign Het
Chtf18 G A 17: 25,939,865 (GRCm39) T747I probably benign Het
Cyp2j6 A G 4: 96,441,684 (GRCm39) L2P probably benign Het
Cyp4f18 G A 8: 72,742,427 (GRCm39) P518S possibly damaging Het
Dmrtc1a G A X: 101,952,221 (GRCm39) R8W probably benign Het
Dpyd T C 3: 118,575,573 (GRCm39) V137A possibly damaging Het
Epha6 A G 16: 59,736,317 (GRCm39) V739A probably damaging Het
Ern2 C T 7: 121,772,431 (GRCm39) A676T probably damaging Het
Fam20c A T 5: 138,743,686 (GRCm39) I241F possibly damaging Het
Foxq1 T C 13: 31,743,251 (GRCm39) Y118H probably damaging Het
Gfm1 C T 3: 67,337,594 (GRCm39) A8V probably benign Het
Gfm2 C T 13: 97,299,500 (GRCm39) T407M possibly damaging Het
Gldc G A 19: 30,120,807 (GRCm39) Q375* probably null Het
Gm5114 A G 7: 39,060,273 (GRCm39) I192T possibly damaging Het
Gnb1 A T 4: 155,639,482 (GRCm39) N237I possibly damaging Het
Herc2 C T 7: 55,879,096 (GRCm39) P4662S possibly damaging Het
Herc3 C T 6: 58,820,754 (GRCm39) S46F possibly damaging Het
Hgsnat C T 8: 26,461,179 (GRCm39) G153E possibly damaging Het
Idh2 TCCCAGG T 7: 79,748,079 (GRCm39) probably benign Het
Igkv2-137 GA GAA 6: 67,533,154 (GRCm39) probably null Het
Invs T A 4: 48,283,267 (GRCm39) D6E probably benign Het
Jakmip3 T C 7: 138,628,613 (GRCm39) V463A probably benign Het
Jarid2 T A 13: 45,001,862 (GRCm39) S96R probably damaging Het
Krtap6-1 A C 16: 88,828,624 (GRCm39) N7H unknown Het
Matn4 A T 2: 164,235,207 (GRCm39) V455D probably damaging Het
Nbea G A 3: 56,090,518 (GRCm39) P47S possibly damaging Het
Oit3 T C 10: 59,263,982 (GRCm39) H384R probably benign Het
Or1e27-ps1 G A 11: 73,556,362 (GRCm39) R309H unknown Het
Or8b42 A T 9: 38,341,850 (GRCm39) I91F probably damaging Het
Pabpc4l T A 3: 46,400,729 (GRCm39) D305V probably damaging Het
Papln G A 12: 83,821,715 (GRCm39) W314* probably null Het
Pask G A 1: 93,248,377 (GRCm39) R975C possibly damaging Het
Pate13 G T 9: 35,820,749 (GRCm39) C111F probably damaging Het
Plce1 A G 19: 38,640,380 (GRCm39) N542S probably benign Het
Rasal1 C T 5: 120,804,420 (GRCm39) R431C probably benign Het
Rnf17 TG T 14: 56,661,999 (GRCm39) 132 probably null Het
Sez6l2 C A 7: 126,557,588 (GRCm39) T334N probably damaging Het
Sh3d19 A G 3: 86,001,071 (GRCm39) T256A probably damaging Het
Slit2 A T 5: 48,387,609 (GRCm39) N545Y probably damaging Het
Sprtn A T 8: 125,629,994 (GRCm39) D429V possibly damaging Het
Srcap T C 7: 127,140,068 (GRCm39) V1389A probably damaging Het
Tecta C A 9: 42,284,349 (GRCm39) C912F probably damaging Het
Tns1 T A 1: 74,024,939 (GRCm39) probably null Het
Tprg1l A G 4: 154,244,860 (GRCm39) V76A probably benign Het
Trav12-2 G T 14: 53,853,840 (GRCm39) probably benign Het
Trio T C 15: 27,881,412 (GRCm39) D612G possibly damaging Het
Usp6nl A T 2: 6,395,900 (GRCm39) Q36H possibly damaging Het
Vps9d1 A T 8: 123,975,544 (GRCm39) M167K possibly damaging Het
Zfhx4 T A 3: 5,466,187 (GRCm39) L2140Q probably damaging Het
Zfp512b A G 2: 181,228,931 (GRCm39) V678A possibly damaging Het
Zfp800 A G 6: 28,242,992 (GRCm39) S658P probably damaging Het
Zscan22 A G 7: 12,637,625 (GRCm39) S6G probably benign Het
Other mutations in Fastkd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01067:Fastkd2 APN 1 63,776,930 (GRCm39) splice site probably benign
IGL01890:Fastkd2 APN 1 63,771,320 (GRCm39) missense probably benign 0.06
IGL02698:Fastkd2 APN 1 63,787,158 (GRCm39) missense probably benign 0.01
IGL02992:Fastkd2 APN 1 63,777,083 (GRCm39) splice site probably benign
IGL03208:Fastkd2 APN 1 63,778,365 (GRCm39) missense probably damaging 1.00
R0172:Fastkd2 UTSW 1 63,771,187 (GRCm39) missense possibly damaging 0.78
R0304:Fastkd2 UTSW 1 63,791,559 (GRCm39) missense possibly damaging 0.46
R0385:Fastkd2 UTSW 1 63,776,970 (GRCm39) missense probably benign 0.01
R0486:Fastkd2 UTSW 1 63,791,499 (GRCm39) missense possibly damaging 0.61
R1115:Fastkd2 UTSW 1 63,787,114 (GRCm39) splice site probably benign
R1468:Fastkd2 UTSW 1 63,771,385 (GRCm39) unclassified probably benign
R1579:Fastkd2 UTSW 1 63,785,046 (GRCm39) missense probably null 0.00
R1729:Fastkd2 UTSW 1 63,790,459 (GRCm39) nonsense probably null
R3937:Fastkd2 UTSW 1 63,776,995 (GRCm39) missense possibly damaging 0.48
R4326:Fastkd2 UTSW 1 63,791,516 (GRCm39) missense probably benign 0.07
R4327:Fastkd2 UTSW 1 63,791,516 (GRCm39) missense probably benign 0.07
R4463:Fastkd2 UTSW 1 63,774,968 (GRCm39) intron probably benign
R4473:Fastkd2 UTSW 1 63,770,833 (GRCm39) missense probably damaging 0.97
R4760:Fastkd2 UTSW 1 63,785,045 (GRCm39) missense probably benign 0.00
R5012:Fastkd2 UTSW 1 63,789,055 (GRCm39) intron probably benign
R5176:Fastkd2 UTSW 1 63,770,598 (GRCm39) unclassified probably benign
R5478:Fastkd2 UTSW 1 63,778,345 (GRCm39) missense probably benign 0.13
R5619:Fastkd2 UTSW 1 63,778,469 (GRCm39) missense probably benign 0.25
R6893:Fastkd2 UTSW 1 63,770,953 (GRCm39) missense possibly damaging 0.75
R7038:Fastkd2 UTSW 1 63,771,032 (GRCm39) missense possibly damaging 0.79
R7049:Fastkd2 UTSW 1 63,771,009 (GRCm39) missense probably benign 0.04
R7510:Fastkd2 UTSW 1 63,776,948 (GRCm39) missense possibly damaging 0.83
R7810:Fastkd2 UTSW 1 63,770,851 (GRCm39) missense possibly damaging 0.61
R7889:Fastkd2 UTSW 1 63,774,619 (GRCm39) splice site probably null
R8263:Fastkd2 UTSW 1 63,770,968 (GRCm39) missense probably benign 0.03
R8271:Fastkd2 UTSW 1 63,787,183 (GRCm39) missense probably benign 0.26
R8468:Fastkd2 UTSW 1 63,770,923 (GRCm39) missense probably benign 0.06
R8767:Fastkd2 UTSW 1 63,775,080 (GRCm39) missense probably benign 0.00
Z1177:Fastkd2 UTSW 1 63,773,996 (GRCm39) critical splice donor site probably null
Z1177:Fastkd2 UTSW 1 63,773,995 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ATGTATGCATGAAATTTAACCTGCC -3'
(R):5'- TGTAATCTCCTAATCCTTTGTCAGAAC -3'

Sequencing Primer
(F):5'- GGTGATTAGACACAAAGATACA -3'
(R):5'- GGGATGCCCATACCAATGTG -3'
Posted On 2020-07-28