Incidental Mutation 'R8321:Vps9d1'
ID641966
Institutional Source Beutler Lab
Gene Symbol Vps9d1
Ensembl Gene ENSMUSG00000001062
Gene NameVPS9 domain containing 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8321 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location123242356-123254348 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 123248805 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 167 (M167K)
Ref Sequence ENSEMBL: ENSMUSP00000113634 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117643] [ENSMUST00000118279] [ENSMUST00000122363] [ENSMUST00000127664] [ENSMUST00000155869]
Predicted Effect probably damaging
Transcript: ENSMUST00000117643
AA Change: M167K

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000113748
Gene: ENSMUSG00000001062
AA Change: M167K

DomainStartEndE-ValueType
low complexity region 96 108 N/A INTRINSIC
coiled coil region 187 220 N/A INTRINSIC
low complexity region 266 279 N/A INTRINSIC
low complexity region 442 453 N/A INTRINSIC
Pfam:VPS9 528 645 8.5e-27 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000118279
AA Change: M167K

PolyPhen 2 Score 0.465 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000113634
Gene: ENSMUSG00000001062
AA Change: M167K

DomainStartEndE-ValueType
low complexity region 96 108 N/A INTRINSIC
coiled coil region 187 220 N/A INTRINSIC
low complexity region 266 279 N/A INTRINSIC
low complexity region 442 453 N/A INTRINSIC
Pfam:VPS9 528 645 1.2e-25 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000122363
AA Change: M167K

PolyPhen 2 Score 0.656 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000113575
Gene: ENSMUSG00000001062
AA Change: M167K

DomainStartEndE-ValueType
low complexity region 96 108 N/A INTRINSIC
coiled coil region 187 220 N/A INTRINSIC
low complexity region 266 279 N/A INTRINSIC
low complexity region 442 453 N/A INTRINSIC
Pfam:VPS9 528 644 5.6e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000155869
AA Change: M167K

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000122184
Gene: ENSMUSG00000001062
AA Change: M167K

DomainStartEndE-ValueType
low complexity region 96 108 N/A INTRINSIC
coiled coil region 187 223 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230113P08Rik G T 9: 35,909,453 C111F probably damaging Het
Arhgap44 A G 11: 65,008,227 V708A probably benign Het
Atg9a G A 1: 75,185,698 Q523* probably null Het
Bank1 T A 3: 136,234,634 E329V possibly damaging Het
Cdh11 T C 8: 102,634,784 R641G probably damaging Het
Cfap58 A G 19: 47,958,147 E373G probably damaging Het
Chd8 T C 14: 52,232,567 T529A probably benign Het
Chtf18 G A 17: 25,720,891 T747I probably benign Het
Cyp2j6 A G 4: 96,553,447 L2P probably benign Het
Cyp4f18 G A 8: 71,988,583 P518S possibly damaging Het
Dmrtc1a G A X: 102,908,615 R8W probably benign Het
Dpyd T C 3: 118,781,924 V137A possibly damaging Het
Epha6 A G 16: 59,915,954 V739A probably damaging Het
Ern2 C T 7: 122,173,208 A676T probably damaging Het
Fam20c A T 5: 138,757,931 I241F possibly damaging Het
Fastkd2 A G 1: 63,747,979 H524R probably benign Het
Foxq1 T C 13: 31,559,268 Y118H probably damaging Het
Gfm1 C T 3: 67,430,261 A8V probably benign Het
Gfm2 C T 13: 97,162,992 T407M possibly damaging Het
Gldc G A 19: 30,143,407 Q375* probably null Het
Gm29096 C A 10: 41,634,033 A859S probably damaging Het
Gm5114 A G 7: 39,410,849 I192T possibly damaging Het
Gnb1 A T 4: 155,555,025 N237I possibly damaging Het
Herc2 C T 7: 56,229,348 P4662S possibly damaging Het
Herc3 C T 6: 58,843,769 S46F possibly damaging Het
Hgsnat C T 8: 25,971,151 G153E possibly damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Igkv2-137 GA GAA 6: 67,556,170 probably null Het
Invs T A 4: 48,283,267 D6E probably benign Het
Jakmip3 T C 7: 139,026,884 V463A probably benign Het
Jarid2 T A 13: 44,848,386 S96R probably damaging Het
Krtap6-1 A C 16: 89,031,736 N7H unknown Het
Matn4 A T 2: 164,393,287 V455D probably damaging Het
Nbea G A 3: 56,183,097 P47S possibly damaging Het
Oit3 T C 10: 59,428,160 H384R probably benign Het
Olfr387-ps1 G A 11: 73,665,536 R309H unknown Het
Olfr901 A T 9: 38,430,554 I91F probably damaging Het
Pabpc4l T A 3: 46,446,294 D305V probably damaging Het
Papln G A 12: 83,774,941 W314* probably null Het
Pask G A 1: 93,320,655 R975C possibly damaging Het
Plce1 A G 19: 38,651,936 N542S probably benign Het
Rasal1 C T 5: 120,666,355 R431C probably benign Het
Rnf17 TG T 14: 56,424,542 probably null Het
Sez6l2 C A 7: 126,958,416 T334N probably damaging Het
Sh3d19 A G 3: 86,093,764 T256A probably damaging Het
Slit2 A T 5: 48,230,267 N545Y probably damaging Het
Sprtn A T 8: 124,903,255 D429V possibly damaging Het
Srcap T C 7: 127,540,896 V1389A probably damaging Het
Tecta C A 9: 42,373,053 C912F probably damaging Het
Tns1 T A 1: 73,985,780 probably null Het
Tprgl A G 4: 154,160,403 V76A probably benign Het
Trav12-2 G T 14: 53,616,383 probably benign Het
Trio T C 15: 27,881,326 D612G possibly damaging Het
Usp6nl A T 2: 6,391,089 Q36H possibly damaging Het
Zfhx4 T A 3: 5,401,127 L2140Q probably damaging Het
Zfp512b A G 2: 181,587,138 V678A possibly damaging Het
Zfp800 A G 6: 28,242,993 S658P probably damaging Het
Zscan22 A G 7: 12,903,698 S6G probably benign Het
Other mutations in Vps9d1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00549:Vps9d1 APN 8 123245198 missense probably damaging 1.00
IGL01112:Vps9d1 APN 8 123246030 missense probably damaging 1.00
IGL01729:Vps9d1 APN 8 123247000 missense probably damaging 1.00
R0568:Vps9d1 UTSW 8 123246748 missense probably damaging 1.00
R1191:Vps9d1 UTSW 8 123247967 missense possibly damaging 0.95
R1813:Vps9d1 UTSW 8 123247039 missense probably damaging 0.99
R1896:Vps9d1 UTSW 8 123247039 missense probably damaging 0.99
R2193:Vps9d1 UTSW 8 123252665 missense probably damaging 1.00
R2256:Vps9d1 UTSW 8 123245121 missense probably benign 0.18
R4305:Vps9d1 UTSW 8 123248237 intron probably benign
R4458:Vps9d1 UTSW 8 123247748 missense probably benign 0.30
R4707:Vps9d1 UTSW 8 123248612 critical splice donor site probably benign
R5366:Vps9d1 UTSW 8 123245114 missense possibly damaging 0.89
R5392:Vps9d1 UTSW 8 123254013 missense probably damaging 0.99
R5423:Vps9d1 UTSW 8 123247965 critical splice donor site probably null
R5645:Vps9d1 UTSW 8 123247748 missense probably benign 0.30
R5647:Vps9d1 UTSW 8 123248859 missense probably damaging 1.00
R5695:Vps9d1 UTSW 8 123246916 missense probably benign
R5908:Vps9d1 UTSW 8 123246824 missense probably benign 0.28
R6061:Vps9d1 UTSW 8 123245671 missense probably damaging 0.99
R6250:Vps9d1 UTSW 8 123248208 critical splice acceptor site probably null
R6416:Vps9d1 UTSW 8 123248639 missense probably damaging 1.00
R6747:Vps9d1 UTSW 8 123254007 missense probably damaging 1.00
R7049:Vps9d1 UTSW 8 123247143 nonsense probably null
R7584:Vps9d1 UTSW 8 123250717 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCGATCACCAGATTCTCCATC -3'
(R):5'- GATCAGACTTCTGCATCCCG -3'

Sequencing Primer
(F):5'- ATCATCTGCCGCTGTAGAGAC -3'
(R):5'- TTGGTCTTAGAACAAGGTCTAAGG -3'
Posted On2020-07-28