Incidental Mutation 'R8321:Rnf17'
ID641981
Institutional Source Beutler Lab
Gene Symbol Rnf17
Ensembl Gene ENSMUSG00000000365
Gene Namering finger protein 17
SynonymsMMIP-2
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.453) question?
Stock #R8321 (G1)
Quality Score217.468
Status Not validated
Chromosome14
Chromosomal Location56402581-56525032 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) TG to T at 56424542 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000093469 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095793] [ENSMUST00000223627]
Predicted Effect probably null
Transcript: ENSMUST00000095793
SMART Domains Protein: ENSMUSP00000093469
Gene: ENSMUSG00000000365

DomainStartEndE-ValueType
Blast:RING 9 72 2e-15 BLAST
low complexity region 398 405 N/A INTRINSIC
Pfam:TUDOR 440 522 8.2e-8 PFAM
TUDOR 750 807 4.32e-12 SMART
low complexity region 824 836 N/A INTRINSIC
Blast:TUDOR 850 882 1e-8 BLAST
low complexity region 959 970 N/A INTRINSIC
TUDOR 984 1042 1.29e-1 SMART
low complexity region 1128 1139 N/A INTRINSIC
TUDOR 1245 1301 7.7e-9 SMART
low complexity region 1416 1430 N/A INTRINSIC
TUDOR 1495 1554 1e-7 SMART
Predicted Effect probably null
Transcript: ENSMUST00000223627
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is similar to a mouse gene that encodes a testis-specific protein containing a RING finger domain. Alternatively spliced transcript variants encoding different isoforms have been found. [provided by RefSeq, May 2010]
PHENOTYPE: Homozygous null mice display male infertility, azoospermia, arrest of spermatogenesis, and small testis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230113P08Rik G T 9: 35,909,453 C111F probably damaging Het
Arhgap44 A G 11: 65,008,227 V708A probably benign Het
Atg9a G A 1: 75,185,698 Q523* probably null Het
Bank1 T A 3: 136,234,634 E329V possibly damaging Het
Cdh11 T C 8: 102,634,784 R641G probably damaging Het
Cfap58 A G 19: 47,958,147 E373G probably damaging Het
Chd8 T C 14: 52,232,567 T529A probably benign Het
Chtf18 G A 17: 25,720,891 T747I probably benign Het
Cyp2j6 A G 4: 96,553,447 L2P probably benign Het
Cyp4f18 G A 8: 71,988,583 P518S possibly damaging Het
Dmrtc1a G A X: 102,908,615 R8W probably benign Het
Dpyd T C 3: 118,781,924 V137A possibly damaging Het
Epha6 A G 16: 59,915,954 V739A probably damaging Het
Ern2 C T 7: 122,173,208 A676T probably damaging Het
Fam20c A T 5: 138,757,931 I241F possibly damaging Het
Fastkd2 A G 1: 63,747,979 H524R probably benign Het
Foxq1 T C 13: 31,559,268 Y118H probably damaging Het
Gfm1 C T 3: 67,430,261 A8V probably benign Het
Gfm2 C T 13: 97,162,992 T407M possibly damaging Het
Gldc G A 19: 30,143,407 Q375* probably null Het
Gm29096 C A 10: 41,634,033 A859S probably damaging Het
Gm5114 A G 7: 39,410,849 I192T possibly damaging Het
Gnb1 A T 4: 155,555,025 N237I possibly damaging Het
Herc2 C T 7: 56,229,348 P4662S possibly damaging Het
Herc3 C T 6: 58,843,769 S46F possibly damaging Het
Hgsnat C T 8: 25,971,151 G153E possibly damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Igkv2-137 GA GAA 6: 67,556,170 probably null Het
Invs T A 4: 48,283,267 D6E probably benign Het
Jakmip3 T C 7: 139,026,884 V463A probably benign Het
Jarid2 T A 13: 44,848,386 S96R probably damaging Het
Krtap6-1 A C 16: 89,031,736 N7H unknown Het
Matn4 A T 2: 164,393,287 V455D probably damaging Het
Nbea G A 3: 56,183,097 P47S possibly damaging Het
Oit3 T C 10: 59,428,160 H384R probably benign Het
Olfr387-ps1 G A 11: 73,665,536 R309H unknown Het
Olfr901 A T 9: 38,430,554 I91F probably damaging Het
Pabpc4l T A 3: 46,446,294 D305V probably damaging Het
Papln G A 12: 83,774,941 W314* probably null Het
Pask G A 1: 93,320,655 R975C possibly damaging Het
Plce1 A G 19: 38,651,936 N542S probably benign Het
Rasal1 C T 5: 120,666,355 R431C probably benign Het
Sez6l2 C A 7: 126,958,416 T334N probably damaging Het
Sh3d19 A G 3: 86,093,764 T256A probably damaging Het
Slit2 A T 5: 48,230,267 N545Y probably damaging Het
Sprtn A T 8: 124,903,255 D429V possibly damaging Het
Srcap T C 7: 127,540,896 V1389A probably damaging Het
Tecta C A 9: 42,373,053 C912F probably damaging Het
Tns1 T A 1: 73,985,780 probably null Het
Tprgl A G 4: 154,160,403 V76A probably benign Het
Trav12-2 G T 14: 53,616,383 probably benign Het
Trio T C 15: 27,881,326 D612G possibly damaging Het
Usp6nl A T 2: 6,391,089 Q36H possibly damaging Het
Vps9d1 A T 8: 123,248,805 M167K possibly damaging Het
Zfhx4 T A 3: 5,401,127 L2140Q probably damaging Het
Zfp512b A G 2: 181,587,138 V678A possibly damaging Het
Zfp800 A G 6: 28,242,993 S658P probably damaging Het
Zscan22 A G 7: 12,903,698 S6G probably benign Het
Other mutations in Rnf17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00586:Rnf17 APN 14 56421082 missense probably damaging 0.99
IGL00717:Rnf17 APN 14 56465750 missense probably benign 0.00
IGL00978:Rnf17 APN 14 56512271 missense probably damaging 1.00
IGL01295:Rnf17 APN 14 56463064 nonsense probably null
IGL01779:Rnf17 APN 14 56462063 missense probably benign 0.06
IGL02132:Rnf17 APN 14 56421166 missense probably benign 0.27
IGL02183:Rnf17 APN 14 56507868 missense probably null 0.99
IGL02387:Rnf17 APN 14 56500587 missense probably damaging 1.00
IGL02422:Rnf17 APN 14 56482135 missense probably damaging 1.00
IGL03081:Rnf17 APN 14 56434371 missense probably benign 0.03
IGL03269:Rnf17 APN 14 56427946 missense possibly damaging 0.74
R0046:Rnf17 UTSW 14 56471373 missense probably damaging 1.00
R0046:Rnf17 UTSW 14 56471373 missense probably damaging 1.00
R0089:Rnf17 UTSW 14 56514106 missense probably damaging 1.00
R0189:Rnf17 UTSW 14 56482193 missense probably null 1.00
R0243:Rnf17 UTSW 14 56482084 missense possibly damaging 0.80
R0245:Rnf17 UTSW 14 56438609 missense probably damaging 0.97
R0486:Rnf17 UTSW 14 56514175 missense probably benign 0.43
R0554:Rnf17 UTSW 14 56522550 missense probably damaging 1.00
R0840:Rnf17 UTSW 14 56475447 missense probably damaging 1.00
R1169:Rnf17 UTSW 14 56514165 missense possibly damaging 0.89
R1170:Rnf17 UTSW 14 56425631 missense probably benign 0.10
R1200:Rnf17 UTSW 14 56467706 missense probably benign 0.44
R1464:Rnf17 UTSW 14 56461911 missense probably damaging 1.00
R1464:Rnf17 UTSW 14 56461911 missense probably damaging 1.00
R1472:Rnf17 UTSW 14 56427979 missense probably damaging 1.00
R1512:Rnf17 UTSW 14 56467786 missense probably benign 0.01
R1605:Rnf17 UTSW 14 56493365 missense probably damaging 1.00
R1778:Rnf17 UTSW 14 56522399 missense probably damaging 0.99
R1791:Rnf17 UTSW 14 56504007 nonsense probably null
R2015:Rnf17 UTSW 14 56486969 missense probably benign 0.00
R2023:Rnf17 UTSW 14 56431579 missense possibly damaging 0.59
R2086:Rnf17 UTSW 14 56483380 missense probably damaging 0.98
R2130:Rnf17 UTSW 14 56493354 missense probably damaging 1.00
R2309:Rnf17 UTSW 14 56505982 missense possibly damaging 0.95
R3003:Rnf17 UTSW 14 56500547 missense probably damaging 1.00
R3611:Rnf17 UTSW 14 56467740 missense probably benign 0.43
R3847:Rnf17 UTSW 14 56512296 missense probably damaging 1.00
R3848:Rnf17 UTSW 14 56512296 missense probably damaging 1.00
R3849:Rnf17 UTSW 14 56512296 missense probably damaging 1.00
R3850:Rnf17 UTSW 14 56512296 missense probably damaging 1.00
R3872:Rnf17 UTSW 14 56475413 missense possibly damaging 0.89
R3874:Rnf17 UTSW 14 56475413 missense possibly damaging 0.89
R4021:Rnf17 UTSW 14 56460001 missense probably damaging 0.98
R4022:Rnf17 UTSW 14 56460001 missense probably damaging 0.98
R4790:Rnf17 UTSW 14 56434355 missense probably damaging 1.00
R4951:Rnf17 UTSW 14 56522391 missense probably benign 0.02
R5068:Rnf17 UTSW 14 56505928 missense probably damaging 0.99
R5069:Rnf17 UTSW 14 56505928 missense probably damaging 0.99
R5070:Rnf17 UTSW 14 56505928 missense probably damaging 0.99
R5518:Rnf17 UTSW 14 56482133 missense probably damaging 1.00
R5628:Rnf17 UTSW 14 56486952 splice site probably null
R5712:Rnf17 UTSW 14 56471399 missense probably benign 0.19
R5747:Rnf17 UTSW 14 56465819 critical splice donor site probably null
R5869:Rnf17 UTSW 14 56505988 missense possibly damaging 0.94
R6336:Rnf17 UTSW 14 56421169 splice site probably null
R6626:Rnf17 UTSW 14 56427924 missense possibly damaging 0.92
R6639:Rnf17 UTSW 14 56438743 missense probably benign 0.01
R6675:Rnf17 UTSW 14 56459975 missense probably damaging 1.00
R6731:Rnf17 UTSW 14 56524350 missense possibly damaging 0.93
R7062:Rnf17 UTSW 14 56465654 missense probably benign 0.00
R7103:Rnf17 UTSW 14 56471306 missense possibly damaging 0.63
R7144:Rnf17 UTSW 14 56512332 splice site probably null
R7527:Rnf17 UTSW 14 56516438 missense probably damaging 1.00
R7664:Rnf17 UTSW 14 56438878 missense probably damaging 1.00
R7754:Rnf17 UTSW 14 56462072 critical splice donor site probably null
R7772:Rnf17 UTSW 14 56477687 missense probably benign 0.27
R8092:Rnf17 UTSW 14 56487022 missense probably benign 0.00
R8150:Rnf17 UTSW 14 56421136 missense probably benign 0.19
R8203:Rnf17 UTSW 14 56467722 missense probably benign 0.17
R8320:Rnf17 UTSW 14 56424542 frame shift probably null
R8379:Rnf17 UTSW 14 56424542 frame shift probably null
R8380:Rnf17 UTSW 14 56424542 frame shift probably null
R8381:Rnf17 UTSW 14 56424542 frame shift probably null
R8382:Rnf17 UTSW 14 56424542 frame shift probably null
R8383:Rnf17 UTSW 14 56424542 frame shift probably null
Z1177:Rnf17 UTSW 14 56467706 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- GAGCTCCTTAACTATCGCAGC -3'
(R):5'- ATACTCAGAAATCCGCCTGC -3'

Sequencing Primer
(F):5'- AAAGTGCTTATTTGTATGCAGGAG -3'
(R):5'- TCCCGAGTGCTGGGATCAAAG -3'
Posted On2020-07-28