Incidental Mutation 'R8321:Gldc'
ID 641986
Institutional Source Beutler Lab
Gene Symbol Gldc
Ensembl Gene ENSMUSG00000024827
Gene Name glycine decarboxylase
Synonyms b2b2679Clo, D030049L12Rik, D19Wsu57e
MMRRC Submission 067723-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8321 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 30075847-30152829 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) G to A at 30120807 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 375 (Q375*)
Ref Sequence ENSEMBL: ENSMUSP00000025778 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025778]
AlphaFold Q91W43
Predicted Effect probably null
Transcript: ENSMUST00000025778
AA Change: Q375*
SMART Domains Protein: ENSMUSP00000025778
Gene: ENSMUSG00000024827
AA Change: Q375*

DomainStartEndE-ValueType
low complexity region 5 28 N/A INTRINSIC
low complexity region 33 56 N/A INTRINSIC
Pfam:GDC-P 70 493 1.1e-202 PFAM
low complexity region 504 515 N/A INTRINSIC
Pfam:GDC-P 519 798 6.5e-8 PFAM
Pfam:Beta_elim_lyase 589 745 2e-10 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Degradation of glycine is brought about by the glycine cleavage system, which is composed of four mitochondrial protein components: P protein (a pyridoxal phosphate-dependent glycine decarboxylase), H protein (a lipoic acid-containing protein), T protein (a tetrahydrofolate-requiring enzyme), and L protein (a lipoamide dehydrogenase). The protein encoded by this gene is the P protein, which binds to glycine and enables the methylamine group from glycine to be transferred to the T protein. Defects in this gene are a cause of nonketotic hyperglycinemia (NKH).[provided by RefSeq, Jan 2010]
PHENOTYPE: Hypomorphic mutants show a developmental delay, hyperglycinemia, altered folate profiles, neural tube defects and postnatal lethality, while survivors show hydrocephaly and premature death. Homozygotes for an ENU allele show omphalocele and severe cardiovascular, craniofacial, renal and eye defects. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, other(2) Gene trapped(4)

Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap44 A G 11: 64,899,053 (GRCm39) V708A probably benign Het
Atg9a G A 1: 75,162,342 (GRCm39) Q523* probably null Het
Bank1 T A 3: 135,940,395 (GRCm39) E329V possibly damaging Het
Ccdc162 C A 10: 41,510,029 (GRCm39) A859S probably damaging Het
Cdh11 T C 8: 103,361,416 (GRCm39) R641G probably damaging Het
Cfap58 A G 19: 47,946,586 (GRCm39) E373G probably damaging Het
Chd8 T C 14: 52,470,024 (GRCm39) T529A probably benign Het
Chtf18 G A 17: 25,939,865 (GRCm39) T747I probably benign Het
Cyp2j6 A G 4: 96,441,684 (GRCm39) L2P probably benign Het
Cyp4f18 G A 8: 72,742,427 (GRCm39) P518S possibly damaging Het
Dmrtc1a G A X: 101,952,221 (GRCm39) R8W probably benign Het
Dpyd T C 3: 118,575,573 (GRCm39) V137A possibly damaging Het
Epha6 A G 16: 59,736,317 (GRCm39) V739A probably damaging Het
Ern2 C T 7: 121,772,431 (GRCm39) A676T probably damaging Het
Fam20c A T 5: 138,743,686 (GRCm39) I241F possibly damaging Het
Fastkd2 A G 1: 63,787,138 (GRCm39) H524R probably benign Het
Foxq1 T C 13: 31,743,251 (GRCm39) Y118H probably damaging Het
Gfm1 C T 3: 67,337,594 (GRCm39) A8V probably benign Het
Gfm2 C T 13: 97,299,500 (GRCm39) T407M possibly damaging Het
Gm5114 A G 7: 39,060,273 (GRCm39) I192T possibly damaging Het
Gnb1 A T 4: 155,639,482 (GRCm39) N237I possibly damaging Het
Herc2 C T 7: 55,879,096 (GRCm39) P4662S possibly damaging Het
Herc3 C T 6: 58,820,754 (GRCm39) S46F possibly damaging Het
Hgsnat C T 8: 26,461,179 (GRCm39) G153E possibly damaging Het
Idh2 TCCCAGG T 7: 79,748,079 (GRCm39) probably benign Het
Igkv2-137 GA GAA 6: 67,533,154 (GRCm39) probably null Het
Invs T A 4: 48,283,267 (GRCm39) D6E probably benign Het
Jakmip3 T C 7: 138,628,613 (GRCm39) V463A probably benign Het
Jarid2 T A 13: 45,001,862 (GRCm39) S96R probably damaging Het
Krtap6-1 A C 16: 88,828,624 (GRCm39) N7H unknown Het
Matn4 A T 2: 164,235,207 (GRCm39) V455D probably damaging Het
Nbea G A 3: 56,090,518 (GRCm39) P47S possibly damaging Het
Oit3 T C 10: 59,263,982 (GRCm39) H384R probably benign Het
Or1e27-ps1 G A 11: 73,556,362 (GRCm39) R309H unknown Het
Or8b42 A T 9: 38,341,850 (GRCm39) I91F probably damaging Het
Pabpc4l T A 3: 46,400,729 (GRCm39) D305V probably damaging Het
Papln G A 12: 83,821,715 (GRCm39) W314* probably null Het
Pask G A 1: 93,248,377 (GRCm39) R975C possibly damaging Het
Pate13 G T 9: 35,820,749 (GRCm39) C111F probably damaging Het
Plce1 A G 19: 38,640,380 (GRCm39) N542S probably benign Het
Rasal1 C T 5: 120,804,420 (GRCm39) R431C probably benign Het
Rnf17 TG T 14: 56,661,999 (GRCm39) 132 probably null Het
Sez6l2 C A 7: 126,557,588 (GRCm39) T334N probably damaging Het
Sh3d19 A G 3: 86,001,071 (GRCm39) T256A probably damaging Het
Slit2 A T 5: 48,387,609 (GRCm39) N545Y probably damaging Het
Sprtn A T 8: 125,629,994 (GRCm39) D429V possibly damaging Het
Srcap T C 7: 127,140,068 (GRCm39) V1389A probably damaging Het
Tecta C A 9: 42,284,349 (GRCm39) C912F probably damaging Het
Tns1 T A 1: 74,024,939 (GRCm39) probably null Het
Tprg1l A G 4: 154,244,860 (GRCm39) V76A probably benign Het
Trav12-2 G T 14: 53,853,840 (GRCm39) probably benign Het
Trio T C 15: 27,881,412 (GRCm39) D612G possibly damaging Het
Usp6nl A T 2: 6,395,900 (GRCm39) Q36H possibly damaging Het
Vps9d1 A T 8: 123,975,544 (GRCm39) M167K possibly damaging Het
Zfhx4 T A 3: 5,466,187 (GRCm39) L2140Q probably damaging Het
Zfp512b A G 2: 181,228,931 (GRCm39) V678A possibly damaging Het
Zfp800 A G 6: 28,242,992 (GRCm39) S658P probably damaging Het
Zscan22 A G 7: 12,637,625 (GRCm39) S6G probably benign Het
Other mutations in Gldc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Gldc APN 19 30,092,640 (GRCm39) missense probably damaging 1.00
IGL01016:Gldc APN 19 30,110,893 (GRCm39) missense possibly damaging 0.93
IGL01112:Gldc APN 19 30,135,913 (GRCm39) critical splice donor site probably null
IGL01510:Gldc APN 19 30,091,121 (GRCm39) critical splice donor site probably null
IGL01516:Gldc APN 19 30,076,432 (GRCm39) missense probably damaging 1.00
IGL01598:Gldc APN 19 30,111,156 (GRCm39) missense probably damaging 1.00
IGL01646:Gldc APN 19 30,078,165 (GRCm39) missense possibly damaging 0.61
IGL02024:Gldc APN 19 30,078,227 (GRCm39) missense probably damaging 1.00
IGL02125:Gldc APN 19 30,124,641 (GRCm39) missense probably benign 0.03
IGL02548:Gldc APN 19 30,077,299 (GRCm39) missense probably benign
IGL02711:Gldc APN 19 30,122,546 (GRCm39) critical splice donor site probably null
IGL02818:Gldc APN 19 30,113,909 (GRCm39) missense probably damaging 0.99
IGL02982:Gldc APN 19 30,122,545 (GRCm39) critical splice donor site probably null
IGL03165:Gldc APN 19 30,076,393 (GRCm39) missense possibly damaging 0.61
jojoba UTSW 19 30,110,912 (GRCm39) missense probably damaging 1.00
miserable UTSW 19 30,128,936 (GRCm39) missense probably damaging 1.00
Urchin UTSW 19 30,096,002 (GRCm39) missense probably damaging 0.98
I2289:Gldc UTSW 19 30,124,576 (GRCm39) nonsense probably null
R0180:Gldc UTSW 19 30,078,217 (GRCm39) missense possibly damaging 0.95
R0269:Gldc UTSW 19 30,096,002 (GRCm39) missense probably damaging 0.98
R0277:Gldc UTSW 19 30,093,851 (GRCm39) missense possibly damaging 0.84
R1085:Gldc UTSW 19 30,128,828 (GRCm39) missense probably damaging 1.00
R1159:Gldc UTSW 19 30,138,162 (GRCm39) intron probably benign
R1500:Gldc UTSW 19 30,091,225 (GRCm39) missense possibly damaging 0.88
R1507:Gldc UTSW 19 30,096,038 (GRCm39) missense probably damaging 1.00
R1592:Gldc UTSW 19 30,138,077 (GRCm39) intron probably benign
R1593:Gldc UTSW 19 30,091,150 (GRCm39) missense probably damaging 1.00
R1675:Gldc UTSW 19 30,120,853 (GRCm39) missense probably damaging 1.00
R1869:Gldc UTSW 19 30,116,732 (GRCm39) missense probably benign
R1965:Gldc UTSW 19 30,114,513 (GRCm39) nonsense probably null
R2312:Gldc UTSW 19 30,078,226 (GRCm39) missense probably damaging 0.98
R2425:Gldc UTSW 19 30,109,190 (GRCm39) missense probably damaging 1.00
R3836:Gldc UTSW 19 30,096,075 (GRCm39) splice site probably benign
R3837:Gldc UTSW 19 30,096,075 (GRCm39) splice site probably benign
R3839:Gldc UTSW 19 30,096,075 (GRCm39) splice site probably benign
R4191:Gldc UTSW 19 30,123,058 (GRCm39) missense probably damaging 0.96
R4380:Gldc UTSW 19 30,138,168 (GRCm39) intron probably benign
R4508:Gldc UTSW 19 30,120,807 (GRCm39) missense probably damaging 1.00
R4570:Gldc UTSW 19 30,151,839 (GRCm39) missense probably benign
R4655:Gldc UTSW 19 30,138,102 (GRCm39) intron probably benign
R4842:Gldc UTSW 19 30,111,132 (GRCm39) missense possibly damaging 0.94
R5070:Gldc UTSW 19 30,095,998 (GRCm39) missense possibly damaging 0.84
R5085:Gldc UTSW 19 30,128,936 (GRCm39) missense probably damaging 1.00
R5268:Gldc UTSW 19 30,123,125 (GRCm39) missense probably damaging 0.96
R5368:Gldc UTSW 19 30,135,921 (GRCm39) missense probably benign
R5718:Gldc UTSW 19 30,088,172 (GRCm39) nonsense probably null
R5878:Gldc UTSW 19 30,120,867 (GRCm39) splice site probably null
R6192:Gldc UTSW 19 30,111,172 (GRCm39) missense probably damaging 0.98
R6453:Gldc UTSW 19 30,093,917 (GRCm39) missense probably damaging 0.99
R6777:Gldc UTSW 19 30,110,912 (GRCm39) missense probably damaging 1.00
R6865:Gldc UTSW 19 30,111,162 (GRCm39) missense possibly damaging 0.92
R7332:Gldc UTSW 19 30,093,926 (GRCm39) missense probably damaging 0.99
R7390:Gldc UTSW 19 30,077,314 (GRCm39) missense possibly damaging 0.46
R7647:Gldc UTSW 19 30,096,067 (GRCm39) missense probably damaging 0.96
R8081:Gldc UTSW 19 30,135,987 (GRCm39) frame shift probably null
R8171:Gldc UTSW 19 30,111,161 (GRCm39) missense probably benign 0.24
R8374:Gldc UTSW 19 30,114,594 (GRCm39) missense probably damaging 1.00
R8503:Gldc UTSW 19 30,077,254 (GRCm39) missense probably benign 0.26
R8510:Gldc UTSW 19 30,093,905 (GRCm39) missense probably damaging 1.00
R8785:Gldc UTSW 19 30,092,634 (GRCm39) missense probably damaging 1.00
R8818:Gldc UTSW 19 30,078,212 (GRCm39) missense probably benign 0.05
R8820:Gldc UTSW 19 30,078,212 (GRCm39) missense probably benign 0.05
R8829:Gldc UTSW 19 30,078,212 (GRCm39) missense probably benign 0.05
R8830:Gldc UTSW 19 30,078,212 (GRCm39) missense probably benign 0.05
R8859:Gldc UTSW 19 30,116,779 (GRCm39) missense probably damaging 1.00
R8887:Gldc UTSW 19 30,111,156 (GRCm39) missense possibly damaging 0.94
R8935:Gldc UTSW 19 30,109,093 (GRCm39) missense probably benign 0.00
R8940:Gldc UTSW 19 30,128,884 (GRCm39) missense probably benign
R9070:Gldc UTSW 19 30,080,404 (GRCm39) missense probably damaging 1.00
R9100:Gldc UTSW 19 30,077,314 (GRCm39) missense possibly damaging 0.81
R9144:Gldc UTSW 19 30,114,593 (GRCm39) missense
R9163:Gldc UTSW 19 30,111,686 (GRCm39) missense probably benign 0.13
R9429:Gldc UTSW 19 30,091,172 (GRCm39) missense possibly damaging 0.88
Z1177:Gldc UTSW 19 30,123,148 (GRCm39) missense possibly damaging 0.61
Z1177:Gldc UTSW 19 30,088,179 (GRCm39) missense probably damaging 0.99
Z1177:Gldc UTSW 19 30,088,178 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCTTCTGTCAGTAAGATCCTTC -3'
(R):5'- GGGAAAGCAAGCCCATCTAC -3'

Sequencing Primer
(F):5'- CAGTAAGATCCTTCCATCTCTAGTG -3'
(R):5'- ACAGCAGCGGTTCTTCAC -3'
Posted On 2020-07-28