Incidental Mutation 'R0109:Vmn2r53'
ID64200
Institutional Source Beutler Lab
Gene Symbol Vmn2r53
Ensembl Gene ENSMUSG00000096002
Gene Namevomeronasal 2, receptor 53
SynonymsEG637908
MMRRC Submission 038395-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.115) question?
Stock #R0109 (G1)
Quality Score207
Status Not validated
Chromosome7
Chromosomal Location12581470-12606544 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 12582066 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 609 (A609T)
Ref Sequence ENSEMBL: ENSMUSP00000126979 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170412]
Predicted Effect probably damaging
Transcript: ENSMUST00000170412
AA Change: A609T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126979
Gene: ENSMUSG00000096002
AA Change: A609T

DomainStartEndE-ValueType
Pfam:ANF_receptor 5 397 3.6e-58 PFAM
Pfam:NCD3G 442 495 2.2e-19 PFAM
Pfam:7tm_3 526 763 3.1e-53 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A T 7: 120,318,762 K1496* probably null Het
Anapc1 C A 2: 128,634,693 R1335L probably damaging Het
Arhgef10l A T 4: 140,578,294 S203T probably benign Het
Astn1 C T 1: 158,664,104 T41I possibly damaging Het
Avil A G 10: 127,013,644 N603S probably benign Het
Brca1 T C 11: 101,531,090 D149G possibly damaging Het
Col19a1 A C 1: 24,559,768 probably null Het
Cps1 T C 1: 67,229,418 V1435A possibly damaging Het
Cyp2j6 A T 4: 96,518,157 I459N probably damaging Het
Cyth1 T C 11: 118,182,306 E242G probably damaging Het
Dclk3 T G 9: 111,467,670 L94R possibly damaging Het
Dsg3 T C 18: 20,540,134 V954A probably damaging Het
Dync2h1 T A 9: 7,111,487 D309V probably damaging Het
Efhd2 A G 4: 141,874,567 F101L probably benign Het
Fgd5 T A 6: 91,988,235 M325K possibly damaging Het
Fras1 T C 5: 96,710,077 S2077P probably benign Het
Frmpd1 A T 4: 45,279,340 E688D probably benign Het
Hspg2 T C 4: 137,562,201 V3824A probably benign Het
Kctd16 A G 18: 40,259,151 E264G probably benign Het
Mapk15 A T 15: 75,996,077 K153* probably null Het
Miox G A 15: 89,335,581 V91I probably benign Het
Nfyb G A 10: 82,755,002 A65V possibly damaging Het
Olfr1241 A G 2: 89,482,803 F111L probably benign Het
Olfr1442 C A 19: 12,674,860 F218L probably benign Het
Olfr646 T C 7: 104,106,605 S109P probably damaging Het
Parp9 T C 16: 35,948,341 I64T probably damaging Het
Pfkfb4 T C 9: 108,998,889 V43A probably benign Het
Pgap1 A T 1: 54,494,825 V643E probably damaging Het
Pip5k1b T A 19: 24,379,047 M176L probably benign Het
Ppfia4 A T 1: 134,324,217 probably null Het
Prdx2 G A 8: 84,970,251 G4S probably benign Het
Rin3 A G 12: 102,313,081 I50V possibly damaging Het
Rtl1 G A 12: 109,595,407 probably benign Het
Sgsm3 G C 15: 81,009,466 D434H probably damaging Het
Shank2 T C 7: 144,410,577 S634P possibly damaging Het
Sik2 A G 9: 50,899,475 M447T possibly damaging Het
Sla2 A G 2: 156,883,587 probably null Het
Spata16 T A 3: 26,913,267 F389I probably damaging Het
Srebf1 G A 11: 60,201,804 A793V probably benign Het
Tmed11 T A 5: 108,777,412 D178V probably damaging Het
Traf7 A G 17: 24,513,926 F110L probably benign Het
Ttn T A 2: 76,725,564 I30366F probably damaging Het
Ubqlnl C T 7: 104,150,192 V33M probably damaging Het
Vmn1r194 A G 13: 22,245,047 Y278C probably damaging Het
Vmn2r100 C A 17: 19,522,120 P252Q possibly damaging Het
Vmn2r114 A T 17: 23,310,575 Y184* probably null Het
Vps13b A G 15: 35,572,119 T961A probably benign Het
Xirp2 T A 2: 67,519,278 N3272K probably damaging Het
Zfp217 C T 2: 170,115,462 A539T probably benign Het
Zfp454 T A 11: 50,883,775 T24S possibly damaging Het
Other mutations in Vmn2r53
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01090:Vmn2r53 APN 7 12600908 missense possibly damaging 0.70
IGL01997:Vmn2r53 APN 7 12582446 missense possibly damaging 0.54
IGL02442:Vmn2r53 APN 7 12581729 missense probably damaging 1.00
IGL02449:Vmn2r53 APN 7 12582361 missense probably damaging 1.00
IGL02589:Vmn2r53 APN 7 12581945 missense possibly damaging 0.93
IGL02986:Vmn2r53 APN 7 12581466 unclassified probably benign
IGL03064:Vmn2r53 APN 7 12601010 missense possibly damaging 0.89
IGL03093:Vmn2r53 APN 7 12600864 missense probably benign 0.03
IGL03244:Vmn2r53 APN 7 12606508 missense probably damaging 1.00
IGL03252:Vmn2r53 APN 7 12606391 missense probably damaging 1.00
IGL03264:Vmn2r53 APN 7 12581892 missense possibly damaging 0.95
IGL03293:Vmn2r53 APN 7 12598422 missense probably benign 0.34
R0453:Vmn2r53 UTSW 7 12582411 missense probably damaging 1.00
R0735:Vmn2r53 UTSW 7 12581780 missense probably benign
R0881:Vmn2r53 UTSW 7 12600932 missense probably benign 0.01
R0894:Vmn2r53 UTSW 7 12601214 missense probably benign 0.00
R0973:Vmn2r53 UTSW 7 12601392 missense probably damaging 1.00
R0973:Vmn2r53 UTSW 7 12601392 missense probably damaging 1.00
R0974:Vmn2r53 UTSW 7 12601392 missense probably damaging 1.00
R0990:Vmn2r53 UTSW 7 12581502 missense probably benign
R1102:Vmn2r53 UTSW 7 12598483 missense possibly damaging 0.94
R1141:Vmn2r53 UTSW 7 12600746 missense possibly damaging 0.54
R1263:Vmn2r53 UTSW 7 12581606 missense probably benign 0.41
R1343:Vmn2r53 UTSW 7 12584774 missense probably benign 0.08
R1750:Vmn2r53 UTSW 7 12581705 missense probably damaging 1.00
R1836:Vmn2r53 UTSW 7 12600885 missense probably damaging 1.00
R2035:Vmn2r53 UTSW 7 12598511 missense possibly damaging 0.76
R2202:Vmn2r53 UTSW 7 12601439 missense probably damaging 1.00
R3707:Vmn2r53 UTSW 7 12582054 missense possibly damaging 0.95
R4372:Vmn2r53 UTSW 7 12581729 missense probably damaging 0.98
R4615:Vmn2r53 UTSW 7 12582302 missense probably damaging 1.00
R4655:Vmn2r53 UTSW 7 12582005 missense possibly damaging 0.83
R4663:Vmn2r53 UTSW 7 12600974 missense probably benign 0.21
R4708:Vmn2r53 UTSW 7 12601202 missense probably benign
R4710:Vmn2r53 UTSW 7 12601202 missense probably benign
R4774:Vmn2r53 UTSW 7 12600765 nonsense probably null
R4859:Vmn2r53 UTSW 7 12601403 missense probably damaging 1.00
R5061:Vmn2r53 UTSW 7 12581814 missense probably benign 0.01
R5561:Vmn2r53 UTSW 7 12601420 missense probably damaging 1.00
R5729:Vmn2r53 UTSW 7 12600806 missense probably damaging 1.00
R6004:Vmn2r53 UTSW 7 12582401 missense probably benign 0.12
R6083:Vmn2r53 UTSW 7 12581881 missense probably benign
R6312:Vmn2r53 UTSW 7 12598639 critical splice acceptor site probably null
R6700:Vmn2r53 UTSW 7 12581706 missense probably damaging 0.96
R6783:Vmn2r53 UTSW 7 12601433 missense probably damaging 1.00
R6852:Vmn2r53 UTSW 7 12606514 missense probably damaging 0.99
R6889:Vmn2r53 UTSW 7 12601142 missense probably benign 0.10
R6940:Vmn2r53 UTSW 7 12582416 missense probably benign 0.19
R7100:Vmn2r53 UTSW 7 12581586 nonsense probably null
R7174:Vmn2r53 UTSW 7 12581701 missense probably benign 0.01
R7213:Vmn2r53 UTSW 7 12601056 missense probably benign 0.17
R7276:Vmn2r53 UTSW 7 12606432 missense probably damaging 0.99
R7515:Vmn2r53 UTSW 7 12581919 missense probably benign 0.05
R7678:Vmn2r53 UTSW 7 12598498 missense probably benign 0.04
R7714:Vmn2r53 UTSW 7 12606491 missense probably damaging 1.00
R7843:Vmn2r53 UTSW 7 12582099 missense probably damaging 1.00
R7926:Vmn2r53 UTSW 7 12582099 missense probably damaging 1.00
Z1176:Vmn2r53 UTSW 7 12601304 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGAACCCTCATGGCATTGGATGAC -3'
(R):5'- TGTTCCTGAAGCACCGGGATACAC -3'

Sequencing Primer
(F):5'- GCATTGGATGACAGTGTGCC -3'
(R):5'- TGTGGTCAGGGCCAACAAC -3'
Posted On2013-08-06