Mutagenetix > Incidental Mutation

Incidental Mutation 'R8322:Itpr1'

642007

Institutional Source

Beutler Lab

Gene Symbol

Itpr1

Ensembl Gene

ENSMUSG00000030102

Gene Name

inositol 1,4,5-trisphosphate receptor 1

Synonyms

P400, Itpr-1, IP3R1, Pcp1, Pcp-1, Ip3r, InsP3R type I, opt

MMRRC Submission

Accession Numbers

NCBI RefSeq: NM_010585.5; MGI: 96623

Essential gene?

Probably essential (E-score: 0.776) question?

Stock #

R8322 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

108213096-108551109 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 108388229 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 880 (N880K)

Ref Sequence

ENSEMBL: ENSMUSP00000032192 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032192] [ENSMUST00000203615] [ENSMUST00000212125]

AlphaFold

no structure available at present

PDB Structure

Crystal structure of the inositol 1,4,5-trisphosphate receptor binding core in complex with IP3 [X-RAY DIFFRACTION]
Crystal structure of the ligand binding suppressor domain of type 1 inositol 1,4,5-trisphosphate receptor [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000032192
AA Change: N880K

PolyPhen 2 Score 0.050 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000032192
Gene: ENSMUSG00000030102
AA Change: N880K

Domain	Start	End	E-Value	Type
MIR	112	166	7.99e-8	SMART
MIR	173	223	1.02e-5	SMART
MIR	231	287	2.33e-9	SMART
MIR	294	403	5.95e-16	SMART
Pfam:RYDR_ITPR	474	670	2.3e-61	PFAM
low complexity region	683	695	N/A	INTRINSIC
low complexity region	884	895	N/A	INTRINSIC
low complexity region	1004	1020	N/A	INTRINSIC
Pfam:RYDR_ITPR	1183	1344	1.9e-14	PFAM
low complexity region	1758	1787	N/A	INTRINSIC
Pfam:RIH_assoc	1959	2069	1.2e-33	PFAM
transmembrane domain	2274	2296	N/A	INTRINSIC
Pfam:Ion_trans	2311	2600	9e-22	PFAM
coiled coil region	2683	2732	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000203615
AA Change: N880K

PolyPhen 2 Score 0.083 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000144880
Gene: ENSMUSG00000030102
AA Change: N880K

Domain	Start	End	E-Value	Type
MIR	112	166	7.99e-8	SMART
MIR	173	223	1.02e-5	SMART
MIR	231	287	2.33e-9	SMART
MIR	294	403	5.95e-16	SMART
Pfam:RYDR_ITPR	474	670	2.3e-61	PFAM
low complexity region	683	695	N/A	INTRINSIC
low complexity region	884	895	N/A	INTRINSIC
low complexity region	1004	1020	N/A	INTRINSIC
Pfam:RYDR_ITPR	1183	1344	1.9e-14	PFAM
low complexity region	1757	1786	N/A	INTRINSIC
Pfam:RIH_assoc	1958	2068	1.2e-33	PFAM
transmembrane domain	2273	2295	N/A	INTRINSIC
Pfam:Ion_trans	2310	2599	9e-22	PFAM
coiled coil region	2682	2731	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000212125
AA Change: N39K

PolyPhen 2 Score 0.885 (Sensitivity: 0.82; Specificity: 0.94)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (64/64)

MGI Phenotype

Strain: 2180360; 3715928; 1856981
Lethality: D10-D21
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an intracellular receptor for inositol 1,4,5-trisphosphate. Upon stimulation by inositol 1,4,5-trisphosphate, this receptor mediates calcium release from the endoplasmic reticulum. Mutations in this gene cause spinocerebellar ataxia type 15, a disease associated with an heterogeneous group of cerebellar disorders. Multiple transcript variants have been identified for this gene. [provided by RefSeq, Nov 2009]
PHENOTYPE: Most homozygotes for a targeted null mutation die in utero, while survivors exhibit severe ataxia, seizures, and lethality by weaning age. Homozygotes for a spontaneous mutation exhibit a postnatal phenotype similar to that of knockout mutants. [provided by MGI curators]

Allele List at MGI

All alleles(71) : Targeted(2) Gene trapped(67) Spontaneous(2)

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700030K09Rik	A	G	8: 72,445,375	S209G	probably benign	Het
Aars	T	C	8: 111,045,528	L450P	possibly damaging	Het
Acsbg1	G	A	9: 54,615,984	T453M	probably benign	Het
Aff3	A	G	1: 38,181,661	S1100P	possibly damaging	Het
B4galt5	G	A	2: 167,348,929	A35V	probably benign	Het
BC017158	C	T	7: 128,290,614	R1H	probably damaging	Het
C1qtnf1	T	C	11: 118,447,857	S118P	probably benign	Het
Ceacam20	A	T	7: 19,971,703	E206D	probably damaging	Het
Celsr3	T	C	9: 108,848,794	L3066P	probably damaging	Het
Cers3	T	G	7: 66,789,638	L299R	probably damaging	Het
Cfhr2	G	T	1: 139,810,958	H288Q	probably benign	Het
Cnot1	A	T	8: 95,769,844	M278K	probably benign	Het
Cnot10	T	C	9: 114,627,469	E166G	probably damaging	Het
Ctsd	T	A	7: 142,385,460	D76V	probably damaging	Het
Cyp1a1	T	A	9: 57,702,720	F472L	probably damaging	Het
Dupd1	A	T	14: 21,702,882	D65E	probably damaging	Het
Dusp19	T	A	2: 80,624,291	D118E	probably damaging	Het
Eif2ak3	C	A	6: 70,878,919	R236S	probably damaging	Het
Fam169a	A	G	13: 97,122,752	T439A	probably benign	Het
Flg	T	C	3: 93,284,332	Y11H	unknown	Het
Fn1	T	A	1: 71,628,459	I792L	probably benign	Het
Fzd7	T	C	1: 59,483,083	S42P	probably benign	Het
Gimap3	A	G	6: 48,765,436	S187P	possibly damaging	Het
Gli1	C	A	10: 127,331,608	R592L	probably damaging	Het
Glt8d2	A	T	10: 82,662,203	I124N	probably damaging	Het
Hbp1	C	T	12: 31,933,388	D356N	probably damaging	Het
Hif1a	T	C	12: 73,939,599	S367P	probably benign	Het
Hspg2	C	G	4: 137,518,979	P1023A	possibly damaging	Het
Kank1	T	C	19: 25,378,478		probably benign	Het
Kat2a	T	C	11: 100,712,290	T39A	unknown	Het
Kcnk2	T	A	1: 189,339,849	Q98L	probably benign	Het
Kcnn4	G	A	7: 24,384,120	G409S	probably benign	Het
Klrb1	T	A	6: 128,713,613	I49F	probably damaging	Het
Larp4	G	A	15: 100,010,356	V573I	probably benign	Het
Lrpprc	A	G	17: 84,740,068		probably null	Het
Mybl1	A	G	1: 9,676,281	S385P	probably damaging	Het
Nup62	T	C	7: 44,829,016	S152P	possibly damaging	Het
Olfr96	A	G	17: 37,225,350	Y75C	probably damaging	Het
Pcdh12	G	A	18: 38,281,577	Q832*	probably null	Het
Pcid2	A	G	8: 13,078,555	I368T	probably damaging	Het
Pcnx4	T	A	12: 72,556,663	F492I	probably damaging	Het
Pi4ka	A	G	16: 17,357,573	Y464H		Het
Plekhg5	T	G	4: 152,104,744	S260R	possibly damaging	Het
Prkdc	T	A	16: 15,714,141		probably benign	Het
Prr14	A	T	7: 127,473,827	E115D	probably benign	Het
Rab3gap2	A	T	1: 185,246,680	N285Y	probably benign	Het
Rhot1	T	A	11: 80,257,560	C609S	possibly damaging	Het
Rnf123	T	C	9: 108,068,507	Q360R	probably benign	Het
Rnf219	A	T	14: 104,479,655	D427E	probably damaging	Het
Rrp12	T	C	19: 41,880,219	T562A	probably benign	Het
Rundc1	G	A	11: 101,432,166	G317D	probably benign	Het
Slc14a1	A	T	18: 78,102,441	I426N	possibly damaging	Het
Slc23a1	C	T	18: 35,622,535	G436E	probably damaging	Het
Slc45a3	A	G	1: 131,977,785	D182G	probably damaging	Het
Sos1	A	T	17: 80,408,299	F1010I	probably damaging	Het
Tap1	A	G	17: 34,193,189	E456G	probably damaging	Het
Tha1	A	T	11: 117,868,667	V332E	probably damaging	Het
Tmem18	T	A	12: 30,588,518	I93N	probably damaging	Het
Tnrc18	A	G	5: 142,726,012	F2664S	probably damaging	Het
Tpm3	T	A	3: 90,073,704		probably benign	Het
Ttc3	A	G	16: 94,454,492	E1615G	probably damaging	Het
Ube3b	A	G	5: 114,402,686	T485A	probably benign	Het
Vmn2r92	A	G	17: 18,166,624	Y75C	probably damaging	Het
Zfp169	T	C	13: 48,491,099	D184G	unknown	Het

Other mutations in Itpr1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00979:Itpr1	APN	6	108471120	missense	probably damaging	0.98
IGL01073:Itpr1	APN	6	108413820	missense	probably benign	0.00
IGL01105:Itpr1	APN	6	108381333	missense	probably benign	0.00
IGL01296:Itpr1	APN	6	108399361	missense	probably damaging	1.00
IGL01325:Itpr1	APN	6	108381208	missense	probably benign	0.01
IGL01418:Itpr1	APN	6	108339624	critical splice donor site	probably null
IGL01464:Itpr1	APN	6	108386727	missense	possibly damaging	0.95
IGL01467:Itpr1	APN	6	108488496	missense	probably damaging	0.96
IGL01645:Itpr1	APN	6	108473599	missense	possibly damaging	0.91
IGL01672:Itpr1	APN	6	108381032	nonsense	probably null
IGL01969:Itpr1	APN	6	108377691	missense	probably damaging	1.00
IGL02164:Itpr1	APN	6	108389483	missense	probably benign	0.08
IGL02206:Itpr1	APN	6	108549820	missense	probably damaging	1.00
IGL02232:Itpr1	APN	6	108417923	missense	probably damaging	1.00
IGL02297:Itpr1	APN	6	108339517	missense	possibly damaging	0.84
IGL02434:Itpr1	APN	6	108489922	splice site	probably null
IGL02568:Itpr1	APN	6	108339554	missense	possibly damaging	0.82
IGL02992:Itpr1	APN	6	108381315	missense	probably damaging	1.00
IGL03109:Itpr1	APN	6	108417981	missense	probably damaging	1.00
IGL03130:Itpr1	APN	6	108523401	missense	probably benign	0.00
IGL03333:Itpr1	APN	6	108380910	unclassified	probably benign
aboriginal	UTSW	6	108515947	missense	probably benign
approximation	UTSW	6	108394841	missense	probably benign
estimate	UTSW	6	108389553	missense	probably null	1.00
icarus	UTSW	6	108410900	missense	probably damaging	1.00
marsupialized	UTSW	6	108394073	splice site	probably null
primordial	UTSW	6	108518755	missense	probably benign	0.06
roo	UTSW	6	108410867	missense	probably benign	0.00
wallaby	UTSW	6	108389387	missense	probably damaging	1.00
P0005:Itpr1	UTSW	6	108381257	missense	probably damaging	1.00
PIT4366001:Itpr1	UTSW	6	108493757	nonsense	probably null
R0019:Itpr1	UTSW	6	108354626	missense	probably damaging	1.00
R0128:Itpr1	UTSW	6	108471209	splice site	probably benign
R0129:Itpr1	UTSW	6	108349676	missense	probably damaging	1.00
R0135:Itpr1	UTSW	6	108488482	splice site	probably benign
R0244:Itpr1	UTSW	6	108473589	missense	probably benign	0.00
R0391:Itpr1	UTSW	6	108378167	missense	probably benign	0.22
R0543:Itpr1	UTSW	6	108515748	splice site	probably benign
R0647:Itpr1	UTSW	6	108383698	missense	probably damaging	1.00
R0766:Itpr1	UTSW	6	108410900	missense	probably damaging	1.00
R0971:Itpr1	UTSW	6	108349629	missense	possibly damaging	0.70
R1083:Itpr1	UTSW	6	108510696	missense	possibly damaging	0.92
R1277:Itpr1	UTSW	6	108339621	missense	probably benign	0.22
R1403:Itpr1	UTSW	6	108389553	missense	probably null	1.00
R1403:Itpr1	UTSW	6	108389553	missense	probably null	1.00
R1404:Itpr1	UTSW	6	108386648	missense	probably benign	0.04
R1404:Itpr1	UTSW	6	108386648	missense	probably benign	0.04
R1605:Itpr1	UTSW	6	108349659	missense	possibly damaging	0.77
R1661:Itpr1	UTSW	6	108482897	missense	probably benign	0.38
R1852:Itpr1	UTSW	6	108386706	missense	probably damaging	1.00
R1929:Itpr1	UTSW	6	108493755	missense	probably damaging	1.00
R2012:Itpr1	UTSW	6	108440536	missense	probably benign	0.02
R2027:Itpr1	UTSW	6	108386853	missense	possibly damaging	0.80
R2111:Itpr1	UTSW	6	108378309	unclassified	probably benign
R2166:Itpr1	UTSW	6	108388225	missense	probably damaging	1.00
R2272:Itpr1	UTSW	6	108493755	missense	probably damaging	1.00
R2484:Itpr1	UTSW	6	108369110	missense	probably damaging	1.00
R3115:Itpr1	UTSW	6	108406109	missense	possibly damaging	0.55
R3751:Itpr1	UTSW	6	108349680	missense	probably damaging	1.00
R3798:Itpr1	UTSW	6	108381270	missense	probably damaging	1.00
R3930:Itpr1	UTSW	6	108394841	missense	probably benign
R4081:Itpr1	UTSW	6	108391835	missense	probably damaging	1.00
R4119:Itpr1	UTSW	6	108394355	missense	probably benign
R4406:Itpr1	UTSW	6	108354663	missense	probably damaging	1.00
R4506:Itpr1	UTSW	6	108432686	missense	probably damaging	1.00
R4616:Itpr1	UTSW	6	108481223	missense	probably damaging	1.00
R4655:Itpr1	UTSW	6	108481293	missense	probably damaging	1.00
R4661:Itpr1	UTSW	6	108410931	critical splice donor site	probably null
R4760:Itpr1	UTSW	6	108349632	missense	probably benign	0.29
R4836:Itpr1	UTSW	6	108389537	missense	probably damaging	0.99
R4857:Itpr1	UTSW	6	108410867	missense	probably benign	0.00
R4876:Itpr1	UTSW	6	108482906	missense	probably damaging	0.97
R4939:Itpr1	UTSW	6	108440558	nonsense	probably null
R5076:Itpr1	UTSW	6	108405529	splice site	probably null
R5088:Itpr1	UTSW	6	108389387	missense	probably damaging	1.00
R5248:Itpr1	UTSW	6	108542062	missense	probably damaging	1.00
R5290:Itpr1	UTSW	6	108406145	missense	possibly damaging	0.95
R5308:Itpr1	UTSW	6	108356511	missense	probably damaging	1.00
R5339:Itpr1	UTSW	6	108393961	missense	probably damaging	1.00
R5368:Itpr1	UTSW	6	108387498	missense	probably damaging	1.00
R5369:Itpr1	UTSW	6	108519424	missense	probably damaging	0.99
R5419:Itpr1	UTSW	6	108493794	missense	possibly damaging	0.95
R5615:Itpr1	UTSW	6	108488600	missense	possibly damaging	0.71
R5779:Itpr1	UTSW	6	108352143	missense	probably damaging	1.00
R5781:Itpr1	UTSW	6	108510738	missense	probably benign	0.23
R5869:Itpr1	UTSW	6	108473529	missense	probably benign	0.30
R5903:Itpr1	UTSW	6	108489797	intron	probably benign
R5929:Itpr1	UTSW	6	108423336	missense	probably benign
R5956:Itpr1	UTSW	6	108506027	missense	probably benign	0.25
R6160:Itpr1	UTSW	6	108518755	missense	probably benign	0.06
R6163:Itpr1	UTSW	6	108388284	missense	probably damaging	1.00
R6169:Itpr1	UTSW	6	108369116	missense	probably damaging	1.00
R6237:Itpr1	UTSW	6	108378203	missense	possibly damaging	0.53
R6398:Itpr1	UTSW	6	108505903	missense	probably damaging	0.96
R6455:Itpr1	UTSW	6	108417972	missense	probably damaging	1.00
R6522:Itpr1	UTSW	6	108388276	missense	probably damaging	1.00
R6524:Itpr1	UTSW	6	108363683	missense	probably damaging	1.00
R6650:Itpr1	UTSW	6	108394073	splice site	probably null
R6806:Itpr1	UTSW	6	108515947	missense	probably benign
R6838:Itpr1	UTSW	6	108471191	missense	possibly damaging	0.87
R6841:Itpr1	UTSW	6	108388192	missense	probably damaging	1.00
R6896:Itpr1	UTSW	6	108481394	missense	probably damaging	1.00
R7014:Itpr1	UTSW	6	108431498	critical splice donor site	probably null
R7076:Itpr1	UTSW	6	108388296	missense	probably benign
R7116:Itpr1	UTSW	6	108481268	missense	probably damaging	0.99
R7152:Itpr1	UTSW	6	108394407	critical splice donor site	probably null
R7161:Itpr1	UTSW	6	108386640	missense	probably damaging	1.00
R7166:Itpr1	UTSW	6	108378190	missense	probably benign	0.06
R7241:Itpr1	UTSW	6	108517620	critical splice donor site	probably null
R7301:Itpr1	UTSW	6	108542024	missense	possibly damaging	0.86
R7330:Itpr1	UTSW	6	108438331	missense	probably benign	0.28
R7449:Itpr1	UTSW	6	108389384	missense	probably damaging	0.98
R7472:Itpr1	UTSW	6	108403396	missense	probably benign	0.05
R7502:Itpr1	UTSW	6	108383678	missense	probably benign	0.00
R7779:Itpr1	UTSW	6	108523348	missense	possibly damaging	0.75
R7828:Itpr1	UTSW	6	108482931	missense	probably damaging	1.00
R7854:Itpr1	UTSW	6	108387369	missense	probably damaging	1.00
R7974:Itpr1	UTSW	6	108523405	missense	possibly damaging	0.86
R7998:Itpr1	UTSW	6	108417948	missense	possibly damaging	0.88
R8039:Itpr1	UTSW	6	108386628	missense	probably damaging	1.00
R8136:Itpr1	UTSW	6	108438360	missense	probably benign	0.18
R8200:Itpr1	UTSW	6	108394865	missense	probably benign	0.00
R8242:Itpr1	UTSW	6	108386697	missense	probably benign	0.44
R8377:Itpr1	UTSW	6	108510738	missense	probably benign	0.00
R8412:Itpr1	UTSW	6	108363620	missense	probably benign	0.07
R8443:Itpr1	UTSW	6	108519348	missense	probably damaging	0.99
R8669:Itpr1	UTSW	6	108393967	missense	probably damaging	0.99
R8697:Itpr1	UTSW	6	108523366	missense	probably damaging	1.00
R8744:Itpr1	UTSW	6	108377802	missense	possibly damaging	0.79
R8870:Itpr1	UTSW	6	108388211	missense	probably damaging	1.00
R8921:Itpr1	UTSW	6	108378198	missense	possibly damaging	0.87
R8961:Itpr1	UTSW	6	108493705	missense	possibly damaging	0.86
R9095:Itpr1	UTSW	6	108387391	missense	probably benign	0.02
R9205:Itpr1	UTSW	6	108489849	missense	probably damaging	0.99
R9282:Itpr1	UTSW	6	108394023	missense	probably damaging	1.00
R9323:Itpr1	UTSW	6	108352018	missense	probably damaging	1.00
R9376:Itpr1	UTSW	6	108349677	missense	probably damaging	0.99
R9392:Itpr1	UTSW	6	108413876	missense	probably benign
R9428:Itpr1	UTSW	6	108401347	missense	possibly damaging	0.84
R9621:Itpr1	UTSW	6	108416909	missense	probably damaging	1.00
R9632:Itpr1	UTSW	6	108405520	missense	possibly damaging	0.50
R9646:Itpr1	UTSW	6	108394884	missense	probably damaging	1.00
R9695:Itpr1	UTSW	6	108401350	missense	probably damaging	1.00
R9710:Itpr1	UTSW	6	108405520	missense	possibly damaging	0.50
R9721:Itpr1	UTSW	6	108406102	missense	probably damaging	0.96
R9780:Itpr1	UTSW	6	108510834	missense	probably benign	0.03
Z1176:Itpr1	UTSW	6	108499149	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GAAATCCAGATGTATGCCTTCTC -3'
(R):5'- GACAGCATGTCACATGATAAGGC -3'

Sequencing Primer
(F):5'- TGCCTTCTCTGACCATAAAGAAGG -3'
(R):5'- GCTGGGGGACATCTGTCAG -3'

Posted On

2020-07-28