Incidental Mutation 'R8322:Pcid2'
ID 642016
Institutional Source Beutler Lab
Gene Symbol Pcid2
Ensembl Gene ENSMUSG00000038542
Gene Name PCI domain containing 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8322 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 13077189-13105459 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 13078555 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 368 (I368T)
Ref Sequence ENSEMBL: ENSMUSP00000133204 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033822] [ENSMUST00000164416] [ENSMUST00000168164] [ENSMUST00000211453]
AlphaFold Q8BFV2
Predicted Effect probably benign
Transcript: ENSMUST00000033822
SMART Domains Protein: ENSMUSP00000033822
Gene: ENSMUSG00000031445

DomainStartEndE-ValueType
low complexity region 5 17 N/A INTRINSIC
GLA 22 86 7.03e-29 SMART
EGF 90 123 1.65e-6 SMART
EGF 128 166 1.19e-3 SMART
Tryp_SPc 182 394 6.49e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000164416
AA Change: I368T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133204
Gene: ENSMUSG00000038542
AA Change: I368T

DomainStartEndE-ValueType
PAM 144 312 4.29e-68 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168164
Predicted Effect probably benign
Transcript: ENSMUST00000211453
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the TREX-2 complex (transcription and export complex 2), which regulates mRNA export from the nucleus. This protein regulates expression of Mad2 mitotic arrest deficient-like 1, a cell division checkpoint protein. This protein also interacts with and stabilizes Brca2 (breast cancer 2) protein. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
PHENOTYPE: Homozygotes for a targeted null mutation implant, but die prior to embryonic day 7.5. Heterozygotes also exhibit excess embryonic loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik A G 8: 72,445,375 S209G probably benign Het
Aars T C 8: 111,045,528 L450P possibly damaging Het
Acsbg1 G A 9: 54,615,984 T453M probably benign Het
Aff3 A G 1: 38,181,661 S1100P possibly damaging Het
B4galt5 G A 2: 167,348,929 A35V probably benign Het
BC017158 C T 7: 128,290,614 R1H probably damaging Het
C1qtnf1 T C 11: 118,447,857 S118P probably benign Het
Ceacam20 A T 7: 19,971,703 E206D probably damaging Het
Celsr3 T C 9: 108,848,794 L3066P probably damaging Het
Cers3 T G 7: 66,789,638 L299R probably damaging Het
Cfhr2 G T 1: 139,810,958 H288Q probably benign Het
Cnot1 A T 8: 95,769,844 M278K probably benign Het
Cnot10 T C 9: 114,627,469 E166G probably damaging Het
Ctsd T A 7: 142,385,460 D76V probably damaging Het
Cyp1a1 T A 9: 57,702,720 F472L probably damaging Het
Dupd1 A T 14: 21,702,882 D65E probably damaging Het
Dusp19 T A 2: 80,624,291 D118E probably damaging Het
Eif2ak3 C A 6: 70,878,919 R236S probably damaging Het
Fam169a A G 13: 97,122,752 T439A probably benign Het
Flg T C 3: 93,284,332 Y11H unknown Het
Fn1 T A 1: 71,628,459 I792L probably benign Het
Fzd7 T C 1: 59,483,083 S42P probably benign Het
Gimap3 A G 6: 48,765,436 S187P possibly damaging Het
Gli1 C A 10: 127,331,608 R592L probably damaging Het
Glt8d2 A T 10: 82,662,203 I124N probably damaging Het
Hbp1 C T 12: 31,933,388 D356N probably damaging Het
Hif1a T C 12: 73,939,599 S367P probably benign Het
Hspg2 C G 4: 137,518,979 P1023A possibly damaging Het
Itpr1 C A 6: 108,388,229 N880K probably benign Het
Kank1 T C 19: 25,378,478 probably benign Het
Kat2a T C 11: 100,712,290 T39A unknown Het
Kcnk2 T A 1: 189,339,849 Q98L probably benign Het
Kcnn4 G A 7: 24,384,120 G409S probably benign Het
Klrb1 T A 6: 128,713,613 I49F probably damaging Het
Larp4 G A 15: 100,010,356 V573I probably benign Het
Lrpprc A G 17: 84,740,068 probably null Het
Mybl1 A G 1: 9,676,281 S385P probably damaging Het
Nup62 T C 7: 44,829,016 S152P possibly damaging Het
Olfr96 A G 17: 37,225,350 Y75C probably damaging Het
Pcdh12 G A 18: 38,281,577 Q832* probably null Het
Pcnx4 T A 12: 72,556,663 F492I probably damaging Het
Pi4ka A G 16: 17,357,573 Y464H Het
Plekhg5 T G 4: 152,104,744 S260R possibly damaging Het
Prkdc T A 16: 15,714,141 probably benign Het
Prr14 A T 7: 127,473,827 E115D probably benign Het
Rab3gap2 A T 1: 185,246,680 N285Y probably benign Het
Rhot1 T A 11: 80,257,560 C609S possibly damaging Het
Rnf123 T C 9: 108,068,507 Q360R probably benign Het
Rnf219 A T 14: 104,479,655 D427E probably damaging Het
Rrp12 T C 19: 41,880,219 T562A probably benign Het
Rundc1 G A 11: 101,432,166 G317D probably benign Het
Slc14a1 A T 18: 78,102,441 I426N possibly damaging Het
Slc23a1 C T 18: 35,622,535 G436E probably damaging Het
Slc45a3 A G 1: 131,977,785 D182G probably damaging Het
Sos1 A T 17: 80,408,299 F1010I probably damaging Het
Tap1 A G 17: 34,193,189 E456G probably damaging Het
Tha1 A T 11: 117,868,667 V332E probably damaging Het
Tmem18 T A 12: 30,588,518 I93N probably damaging Het
Tnrc18 A G 5: 142,726,012 F2664S probably damaging Het
Tpm3 T A 3: 90,073,704 probably benign Het
Ttc3 A G 16: 94,454,492 E1615G probably damaging Het
Ube3b A G 5: 114,402,686 T485A probably benign Het
Vmn2r92 A G 17: 18,166,624 Y75C probably damaging Het
Zfp169 T C 13: 48,491,099 D184G unknown Het
Other mutations in Pcid2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01286:Pcid2 APN 8 13090660 missense probably damaging 1.00
IGL01526:Pcid2 APN 8 13085319 unclassified probably benign
IGL01603:Pcid2 APN 8 13079936 missense possibly damaging 0.49
IGL01867:Pcid2 APN 8 13078243 missense probably benign 0.06
raton UTSW 8 13085425 missense probably damaging 1.00
R0091:Pcid2 UTSW 8 13085392 missense probably benign 0.00
R0322:Pcid2 UTSW 8 13090775 intron probably benign
R0403:Pcid2 UTSW 8 13085367 missense probably damaging 1.00
R0426:Pcid2 UTSW 8 13081262 critical splice donor site probably null
R1914:Pcid2 UTSW 8 13094141 critical splice donor site probably null
R3498:Pcid2 UTSW 8 13100413 missense possibly damaging 0.46
R4432:Pcid2 UTSW 8 13085421 missense probably damaging 0.99
R4832:Pcid2 UTSW 8 13085425 missense probably damaging 1.00
R5106:Pcid2 UTSW 8 13079648 missense probably damaging 1.00
R5169:Pcid2 UTSW 8 13079632 splice site probably null
R5788:Pcid2 UTSW 8 13100320 splice site probably null
R7048:Pcid2 UTSW 8 13078243 missense probably benign 0.06
R7219:Pcid2 UTSW 8 13079907 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTCCCTGGGGACACACTAGTAC -3'
(R):5'- TCACCAAATAATGTCACTGCCTG -3'

Sequencing Primer
(F):5'- GGACACACTAGTACAGGTTATAGCC -3'
(R):5'- AAATAATGTCACTGCCTGTCCTCTGG -3'
Posted On 2020-07-28