Incidental Mutation 'R8322:Rnf123'
ID 642022
Institutional Source Beutler Lab
Gene Symbol Rnf123
Ensembl Gene ENSMUSG00000041528
Gene Name ring finger protein 123
Synonyms KPC1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.332) question?
Stock # R8322 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 108051534-108083346 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 108068507 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Arginine at position 360 (Q360R)
Ref Sequence ENSEMBL: ENSMUSP00000125745 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047746] [ENSMUST00000160249] [ENSMUST00000160649] [ENSMUST00000161828] [ENSMUST00000162355] [ENSMUST00000162516] [ENSMUST00000174504] [ENSMUST00000178267]
AlphaFold Q5XPI3
Predicted Effect probably benign
Transcript: ENSMUST00000047746
AA Change: Q360R

PolyPhen 2 Score 0.261 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000040803
Gene: ENSMUSG00000041528
AA Change: Q360R

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1047 1067 N/A INTRINSIC
low complexity region 1242 1251 N/A INTRINSIC
RING 1260 1297 5.27e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160249
AA Change: Q360R

PolyPhen 2 Score 0.450 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000124548
Gene: ENSMUSG00000041528
AA Change: Q360R

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
low complexity region 1236 1245 N/A INTRINSIC
RING 1254 1291 5.27e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160649
AA Change: Q360R

PolyPhen 2 Score 0.450 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000125495
Gene: ENSMUSG00000041528
AA Change: Q360R

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161828
Predicted Effect probably benign
Transcript: ENSMUST00000162355
AA Change: Q360R

PolyPhen 2 Score 0.261 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000125745
Gene: ENSMUSG00000041528
AA Change: Q360R

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1047 1067 N/A INTRINSIC
low complexity region 1242 1251 N/A INTRINSIC
RING 1260 1297 5.27e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162516
Predicted Effect probably benign
Transcript: ENSMUST00000174504
Predicted Effect probably benign
Transcript: ENSMUST00000178267
AA Change: Q360R

PolyPhen 2 Score 0.450 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000136953
Gene: ENSMUSG00000041528
AA Change: Q360R

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
low complexity region 1236 1245 N/A INTRINSIC
RING 1254 1291 5.27e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a C-terminal RING finger domain, a motif present in a variety of functionally distinct proteins and known to be involved in protein-protein and protein-DNA interactions, and an N-terminal SPRY domain. This protein displays E3 ubiquitin ligase activity toward the cyclin-dependent kinase inhibitor 1B which is also known as p27 or KIP1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik A G 8: 72,445,375 S209G probably benign Het
Aars T C 8: 111,045,528 L450P possibly damaging Het
Acsbg1 G A 9: 54,615,984 T453M probably benign Het
Aff3 A G 1: 38,181,661 S1100P possibly damaging Het
B4galt5 G A 2: 167,348,929 A35V probably benign Het
BC017158 C T 7: 128,290,614 R1H probably damaging Het
C1qtnf1 T C 11: 118,447,857 S118P probably benign Het
Ceacam20 A T 7: 19,971,703 E206D probably damaging Het
Celsr3 T C 9: 108,848,794 L3066P probably damaging Het
Cers3 T G 7: 66,789,638 L299R probably damaging Het
Cfhr2 G T 1: 139,810,958 H288Q probably benign Het
Cnot1 A T 8: 95,769,844 M278K probably benign Het
Cnot10 T C 9: 114,627,469 E166G probably damaging Het
Ctsd T A 7: 142,385,460 D76V probably damaging Het
Cyp1a1 T A 9: 57,702,720 F472L probably damaging Het
Dupd1 A T 14: 21,702,882 D65E probably damaging Het
Dusp19 T A 2: 80,624,291 D118E probably damaging Het
Eif2ak3 C A 6: 70,878,919 R236S probably damaging Het
Fam169a A G 13: 97,122,752 T439A probably benign Het
Flg T C 3: 93,284,332 Y11H unknown Het
Fn1 T A 1: 71,628,459 I792L probably benign Het
Fzd7 T C 1: 59,483,083 S42P probably benign Het
Gimap3 A G 6: 48,765,436 S187P possibly damaging Het
Gli1 C A 10: 127,331,608 R592L probably damaging Het
Glt8d2 A T 10: 82,662,203 I124N probably damaging Het
Hbp1 C T 12: 31,933,388 D356N probably damaging Het
Hif1a T C 12: 73,939,599 S367P probably benign Het
Hspg2 C G 4: 137,518,979 P1023A possibly damaging Het
Itpr1 C A 6: 108,388,229 N880K probably benign Het
Kank1 T C 19: 25,378,478 probably benign Het
Kat2a T C 11: 100,712,290 T39A unknown Het
Kcnk2 T A 1: 189,339,849 Q98L probably benign Het
Kcnn4 G A 7: 24,384,120 G409S probably benign Het
Klrb1 T A 6: 128,713,613 I49F probably damaging Het
Larp4 G A 15: 100,010,356 V573I probably benign Het
Lrpprc A G 17: 84,740,068 probably null Het
Mybl1 A G 1: 9,676,281 S385P probably damaging Het
Nup62 T C 7: 44,829,016 S152P possibly damaging Het
Olfr96 A G 17: 37,225,350 Y75C probably damaging Het
Pcdh12 G A 18: 38,281,577 Q832* probably null Het
Pcid2 A G 8: 13,078,555 I368T probably damaging Het
Pcnx4 T A 12: 72,556,663 F492I probably damaging Het
Pi4ka A G 16: 17,357,573 Y464H Het
Plekhg5 T G 4: 152,104,744 S260R possibly damaging Het
Prkdc T A 16: 15,714,141 probably benign Het
Prr14 A T 7: 127,473,827 E115D probably benign Het
Rab3gap2 A T 1: 185,246,680 N285Y probably benign Het
Rhot1 T A 11: 80,257,560 C609S possibly damaging Het
Rnf219 A T 14: 104,479,655 D427E probably damaging Het
Rrp12 T C 19: 41,880,219 T562A probably benign Het
Rundc1 G A 11: 101,432,166 G317D probably benign Het
Slc14a1 A T 18: 78,102,441 I426N possibly damaging Het
Slc23a1 C T 18: 35,622,535 G436E probably damaging Het
Slc45a3 A G 1: 131,977,785 D182G probably damaging Het
Sos1 A T 17: 80,408,299 F1010I probably damaging Het
Tap1 A G 17: 34,193,189 E456G probably damaging Het
Tha1 A T 11: 117,868,667 V332E probably damaging Het
Tmem18 T A 12: 30,588,518 I93N probably damaging Het
Tnrc18 A G 5: 142,726,012 F2664S probably damaging Het
Tpm3 T A 3: 90,073,704 probably benign Het
Ttc3 A G 16: 94,454,492 E1615G probably damaging Het
Ube3b A G 5: 114,402,686 T485A probably benign Het
Vmn2r92 A G 17: 18,166,624 Y75C probably damaging Het
Zfp169 T C 13: 48,491,099 D184G unknown Het
Other mutations in Rnf123
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Rnf123 APN 9 108067395 critical splice donor site probably null
IGL01358:Rnf123 APN 9 108069182 missense probably damaging 1.00
IGL01464:Rnf123 APN 9 108052302 missense probably damaging 1.00
IGL01637:Rnf123 APN 9 108058238 missense probably damaging 1.00
IGL01669:Rnf123 APN 9 108058356 missense probably damaging 0.98
IGL01905:Rnf123 APN 9 108071370 splice site probably benign
IGL02070:Rnf123 APN 9 108068302 nonsense probably null
IGL02072:Rnf123 APN 9 108068302 nonsense probably null
IGL02073:Rnf123 APN 9 108068302 nonsense probably null
IGL02074:Rnf123 APN 9 108066889 missense probably damaging 1.00
IGL02079:Rnf123 APN 9 108068302 nonsense probably null
IGL02080:Rnf123 APN 9 108068302 nonsense probably null
IGL02231:Rnf123 APN 9 108066399 missense probably benign 0.17
IGL02281:Rnf123 APN 9 108071452 missense probably benign 0.01
IGL02336:Rnf123 APN 9 108061842 missense probably damaging 1.00
IGL02543:Rnf123 APN 9 108066348 missense probably damaging 1.00
IGL02565:Rnf123 APN 9 108052212 critical splice donor site probably null
IGL02571:Rnf123 APN 9 108068302 nonsense probably null
IGL02572:Rnf123 APN 9 108068302 nonsense probably null
IGL02574:Rnf123 APN 9 108068302 nonsense probably null
IGL02586:Rnf123 APN 9 108068302 nonsense probably null
IGL02589:Rnf123 APN 9 108068302 nonsense probably null
IGL02600:Rnf123 APN 9 108068302 nonsense probably null
IGL02601:Rnf123 APN 9 108068302 nonsense probably null
IGL02602:Rnf123 APN 9 108068302 nonsense probably null
IGL02603:Rnf123 APN 9 108068302 nonsense probably null
IGL02609:Rnf123 APN 9 108068302 nonsense probably null
IGL02628:Rnf123 APN 9 108068302 nonsense probably null
IGL02629:Rnf123 APN 9 108068302 nonsense probably null
IGL02629:Rnf123 APN 9 108070789 splice site probably benign
IGL02630:Rnf123 APN 9 108068302 nonsense probably null
IGL02631:Rnf123 APN 9 108068302 nonsense probably null
IGL02632:Rnf123 APN 9 108068302 nonsense probably null
IGL02650:Rnf123 APN 9 108069748 missense probably benign 0.29
IGL02690:Rnf123 APN 9 108068302 nonsense probably null
IGL02691:Rnf123 APN 9 108068302 nonsense probably null
IGL02692:Rnf123 APN 9 108068302 nonsense probably null
IGL02693:Rnf123 APN 9 108068302 nonsense probably null
IGL02713:Rnf123 APN 9 108068302 nonsense probably null
IGL02736:Rnf123 APN 9 108068302 nonsense probably null
IGL02929:Rnf123 APN 9 108069076 missense probably benign
R1175:Rnf123 UTSW 9 108077373 missense probably benign
R1465:Rnf123 UTSW 9 108071466 splice site probably benign
R1502:Rnf123 UTSW 9 108068510 splice site probably null
R1682:Rnf123 UTSW 9 108077398 missense probably benign 0.16
R1817:Rnf123 UTSW 9 108062926 missense probably benign 0.41
R1855:Rnf123 UTSW 9 108061791 missense probably damaging 1.00
R2394:Rnf123 UTSW 9 108063536 missense probably benign 0.00
R2483:Rnf123 UTSW 9 108063521 missense probably benign 0.16
R3896:Rnf123 UTSW 9 108069103 splice site probably benign
R3940:Rnf123 UTSW 9 108064035 splice site probably benign
R4206:Rnf123 UTSW 9 108063963 missense probably benign 0.01
R4641:Rnf123 UTSW 9 108058587 missense probably damaging 1.00
R4714:Rnf123 UTSW 9 108052439 splice site probably null
R4767:Rnf123 UTSW 9 108052089 missense probably damaging 1.00
R4849:Rnf123 UTSW 9 108056091 missense probably damaging 1.00
R4899:Rnf123 UTSW 9 108063680 missense probably damaging 1.00
R5274:Rnf123 UTSW 9 108064003 frame shift probably null
R5275:Rnf123 UTSW 9 108064003 frame shift probably null
R5276:Rnf123 UTSW 9 108064003 frame shift probably null
R5294:Rnf123 UTSW 9 108064003 frame shift probably null
R5295:Rnf123 UTSW 9 108064003 frame shift probably null
R5394:Rnf123 UTSW 9 108070731 missense probably damaging 1.00
R5717:Rnf123 UTSW 9 108067424 missense probably damaging 1.00
R6186:Rnf123 UTSW 9 108069958 missense possibly damaging 0.55
R6449:Rnf123 UTSW 9 108056053 missense probably benign 0.17
R6502:Rnf123 UTSW 9 108068332 missense possibly damaging 0.46
R6944:Rnf123 UTSW 9 108063623 missense probably benign 0.02
R7003:Rnf123 UTSW 9 108063683 critical splice acceptor site probably null
R7088:Rnf123 UTSW 9 108058536 missense probably null 1.00
R7092:Rnf123 UTSW 9 108068600 missense probably benign 0.07
R7100:Rnf123 UTSW 9 108056639 missense probably damaging 1.00
R7257:Rnf123 UTSW 9 108069029 missense probably damaging 1.00
R7453:Rnf123 UTSW 9 108070408 splice site probably null
R7468:Rnf123 UTSW 9 108069009 missense probably benign 0.00
R7517:Rnf123 UTSW 9 108070274 nonsense probably null
R7577:Rnf123 UTSW 9 108070619 missense probably damaging 1.00
R8296:Rnf123 UTSW 9 108062890 missense probably damaging 1.00
R8754:Rnf123 UTSW 9 108071164 missense probably damaging 1.00
R8783:Rnf123 UTSW 9 108069073 missense probably benign
R9052:Rnf123 UTSW 9 108059731 missense probably damaging 1.00
R9156:Rnf123 UTSW 9 108063028 splice site probably benign
R9170:Rnf123 UTSW 9 108071176 missense probably damaging 1.00
R9332:Rnf123 UTSW 9 108067505 missense probably benign 0.00
R9385:Rnf123 UTSW 9 108052268 missense probably benign 0.02
R9394:Rnf123 UTSW 9 108065706 missense probably damaging 1.00
R9432:Rnf123 UTSW 9 108059809 missense probably damaging 0.96
R9717:Rnf123 UTSW 9 108077764 missense probably benign 0.43
Z1176:Rnf123 UTSW 9 108058395 missense probably damaging 1.00
Z1176:Rnf123 UTSW 9 108062981 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGGGACAATAGGCGAGAATC -3'
(R):5'- GCCTGCTTCTTCAACACAAG -3'

Sequencing Primer
(F):5'- GTGACATCATCAACTGCTTCAGG -3'
(R):5'- TCTTCAACACAAGAAGAGGTCTCCTG -3'
Posted On 2020-07-28