Incidental Mutation 'R8322:Tha1'
ID642030
Institutional Source Beutler Lab
Gene Symbol Tha1
Ensembl Gene ENSMUSG00000017713
Gene Namethreonine aldolase 1
SynonymsGLY1, 1300017K07Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R8322 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location117867952-117873481 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 117868667 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 332 (V332E)
Ref Sequence ENSEMBL: ENSMUSP00000033230 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033230] [ENSMUST00000093905]
Predicted Effect probably damaging
Transcript: ENSMUST00000033230
AA Change: V332E

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000033230
Gene: ENSMUSG00000017713
AA Change: V332E

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Beta_elim_lyase 42 334 4.6e-91 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000093905
SMART Domains Protein: ENSMUSP00000091432
Gene: ENSMUSG00000070330

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 4 190 9.7e-14 PFAM
Pfam:Claudin_2 16 192 1.3e-45 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik A G 8: 72,445,375 S209G probably benign Het
Aars T C 8: 111,045,528 L450P possibly damaging Het
Acsbg1 G A 9: 54,615,984 T453M probably benign Het
Aff3 A G 1: 38,181,661 S1100P possibly damaging Het
B4galt5 G A 2: 167,348,929 A35V probably benign Het
BC017158 C T 7: 128,290,614 R1H probably damaging Het
C1qtnf1 T C 11: 118,447,857 S118P probably benign Het
Ceacam20 A T 7: 19,971,703 E206D probably damaging Het
Celsr3 T C 9: 108,848,794 L3066P probably damaging Het
Cers3 T G 7: 66,789,638 L299R probably damaging Het
Cfhr2 G T 1: 139,810,958 H288Q probably benign Het
Cnot1 A T 8: 95,769,844 M278K probably benign Het
Cnot10 T C 9: 114,627,469 E166G probably damaging Het
Ctsd T A 7: 142,385,460 D76V probably damaging Het
Cyp1a1 T A 9: 57,702,720 F472L probably damaging Het
Dupd1 A T 14: 21,702,882 D65E probably damaging Het
Dusp19 T A 2: 80,624,291 D118E probably damaging Het
Eif2ak3 C A 6: 70,878,919 R236S probably damaging Het
Fam169a A G 13: 97,122,752 T439A probably benign Het
Flg T C 3: 93,284,332 Y11H unknown Het
Fn1 T A 1: 71,628,459 I792L probably benign Het
Fzd7 T C 1: 59,483,083 S42P probably benign Het
Gimap3 A G 6: 48,765,436 S187P possibly damaging Het
Gli1 C A 10: 127,331,608 R592L probably damaging Het
Glt8d2 A T 10: 82,662,203 I124N probably damaging Het
Hbp1 C T 12: 31,933,388 D356N probably damaging Het
Hif1a T C 12: 73,939,599 S367P probably benign Het
Hspg2 C G 4: 137,518,979 P1023A possibly damaging Het
Itpr1 C A 6: 108,388,229 N880K probably benign Het
Kank1 T C 19: 25,378,478 probably benign Het
Kat2a T C 11: 100,712,290 T39A unknown Het
Kcnk2 T A 1: 189,339,849 Q98L probably benign Het
Kcnn4 G A 7: 24,384,120 G409S probably benign Het
Klrb1 T A 6: 128,713,613 I49F probably damaging Het
Larp4 G A 15: 100,010,356 V573I probably benign Het
Lrpprc A G 17: 84,740,068 probably null Het
Mybl1 A G 1: 9,676,281 S385P probably damaging Het
Nup62 T C 7: 44,829,016 S152P possibly damaging Het
Olfr96 A G 17: 37,225,350 Y75C probably damaging Het
Pcdh12 G A 18: 38,281,577 Q832* probably null Het
Pcid2 A G 8: 13,078,555 I368T probably damaging Het
Pcnx4 T A 12: 72,556,663 F492I probably damaging Het
Pi4ka A G 16: 17,357,573 Y464H Het
Plekhg5 T G 4: 152,104,744 S260R possibly damaging Het
Prr14 A T 7: 127,473,827 E115D probably benign Het
Rab3gap2 A T 1: 185,246,680 N285Y probably benign Het
Rhot1 T A 11: 80,257,560 C609S possibly damaging Het
Rnf123 T C 9: 108,068,507 Q360R probably benign Het
Rnf219 A T 14: 104,479,655 D427E probably damaging Het
Rrp12 T C 19: 41,880,219 T562A probably benign Het
Rundc1 G A 11: 101,432,166 G317D probably benign Het
Slc14a1 A T 18: 78,102,441 I426N possibly damaging Het
Slc23a1 C T 18: 35,622,535 G436E probably damaging Het
Slc45a3 A G 1: 131,977,785 D182G probably damaging Het
Sos1 A T 17: 80,408,299 F1010I probably damaging Het
Tap1 A G 17: 34,193,189 E456G probably damaging Het
Tmem18 T A 12: 30,588,518 I93N probably damaging Het
Tnrc18 A G 5: 142,726,012 F2664S probably damaging Het
Ttc3 A G 16: 94,454,492 E1615G probably damaging Het
Ube3b A G 5: 114,402,686 T485A probably benign Het
Vmn2r92 A G 17: 18,166,624 Y75C probably damaging Het
Zfp169 T C 13: 48,491,099 D184G unknown Het
Other mutations in Tha1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Tha1 APN 11 117871005 splice site probably benign
IGL01434:Tha1 APN 11 117868599 missense probably benign 0.31
IGL01658:Tha1 APN 11 117871612 missense probably damaging 1.00
R0437:Tha1 UTSW 11 117868575 missense probably benign 0.17
R0671:Tha1 UTSW 11 117873157 splice site probably benign
R1958:Tha1 UTSW 11 117869353 unclassified probably benign
R2127:Tha1 UTSW 11 117869774 missense probably damaging 0.98
R3416:Tha1 UTSW 11 117873200 missense possibly damaging 0.67
R4825:Tha1 UTSW 11 117869379 missense probably damaging 1.00
R5145:Tha1 UTSW 11 117869676 missense probably damaging 1.00
R5266:Tha1 UTSW 11 117869676 missense probably damaging 1.00
R5267:Tha1 UTSW 11 117869676 missense probably damaging 1.00
R5339:Tha1 UTSW 11 117871082 missense possibly damaging 0.87
R5858:Tha1 UTSW 11 117873384 missense unknown
R6820:Tha1 UTSW 11 117871678 missense probably benign 0.00
R7399:Tha1 UTSW 11 117869690 missense possibly damaging 0.86
R7706:Tha1 UTSW 11 117869455 missense probably damaging 1.00
R7905:Tha1 UTSW 11 117871067 missense possibly damaging 0.91
R8094:Tha1 UTSW 11 117868497 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGCTTCAGGCATCTCACTGC -3'
(R):5'- ATAATCGGGGTGCCCTTCTG -3'

Sequencing Primer
(F):5'- ACTCCAATCGTAGCACGGG -3'
(R):5'- GGGGTGCCCTTCTGCCTTC -3'
Posted On2020-07-28