Incidental Mutation 'R8322:Zfp169'
ID 642036
Institutional Source Beutler Lab
Gene Symbol Zfp169
Ensembl Gene ENSMUSG00000050954
Gene Name zinc finger protein 169
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock # R8322 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 48487647-48513451 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 48491099 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 184 (D184G)
Ref Sequence ENSEMBL: ENSMUSP00000135414 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110110] [ENSMUST00000167682] [ENSMUST00000176176] [ENSMUST00000176949] [ENSMUST00000176996] [ENSMUST00000177530]
AlphaFold E9Q3R6
Predicted Effect unknown
Transcript: ENSMUST00000110110
AA Change: D184G
SMART Domains Protein: ENSMUSP00000105737
Gene: ENSMUSG00000050954
AA Change: D184G

DomainStartEndE-ValueType
KRAB 14 74 9.74e-36 SMART
ZnF_C2H2 257 279 9.08e-4 SMART
ZnF_C2H2 285 308 2.2e-2 SMART
ZnF_C2H2 314 336 9.73e-4 SMART
ZnF_C2H2 342 364 2.86e-1 SMART
ZnF_C2H2 370 392 4.72e-2 SMART
ZnF_C2H2 398 420 4.24e-4 SMART
ZnF_C2H2 426 448 1.13e-4 SMART
ZnF_C2H2 454 476 2.2e-2 SMART
ZnF_C2H2 482 504 2.99e-4 SMART
ZnF_C2H2 510 532 2.57e-3 SMART
ZnF_C2H2 539 561 3.44e-4 SMART
ZnF_C2H2 567 589 3.69e-4 SMART
ZnF_C2H2 595 617 8.02e-5 SMART
ZnF_C2H2 623 645 1.26e-2 SMART
ZnF_C2H2 651 673 4.79e-3 SMART
ZnF_C2H2 679 701 1.3e-4 SMART
ZnF_C2H2 707 729 5.5e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167682
SMART Domains Protein: ENSMUSP00000127591
Gene: ENSMUSG00000050954

DomainStartEndE-ValueType
KRAB 14 74 9.74e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176176
SMART Domains Protein: ENSMUSP00000134793
Gene: ENSMUSG00000050954

DomainStartEndE-ValueType
KRAB 14 74 9.74e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176949
SMART Domains Protein: ENSMUSP00000135695
Gene: ENSMUSG00000050954

DomainStartEndE-ValueType
KRAB 14 74 9.74e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176996
SMART Domains Protein: ENSMUSP00000135520
Gene: ENSMUSG00000050954

DomainStartEndE-ValueType
KRAB 14 74 9.74e-36 SMART
Predicted Effect unknown
Transcript: ENSMUST00000177530
AA Change: D184G
SMART Domains Protein: ENSMUSP00000135414
Gene: ENSMUSG00000050954
AA Change: D184G

DomainStartEndE-ValueType
KRAB 14 74 9.74e-36 SMART
ZnF_C2H2 257 279 9.08e-4 SMART
ZnF_C2H2 285 308 2.2e-2 SMART
ZnF_C2H2 314 336 9.73e-4 SMART
ZnF_C2H2 342 364 2.86e-1 SMART
ZnF_C2H2 370 392 4.72e-2 SMART
ZnF_C2H2 398 420 4.24e-4 SMART
ZnF_C2H2 426 448 1.13e-4 SMART
ZnF_C2H2 454 476 2.2e-2 SMART
ZnF_C2H2 482 504 2.99e-4 SMART
ZnF_C2H2 510 532 2.57e-3 SMART
ZnF_C2H2 539 561 3.44e-4 SMART
ZnF_C2H2 567 589 3.69e-4 SMART
ZnF_C2H2 595 617 8.02e-5 SMART
ZnF_C2H2 623 645 1.26e-2 SMART
ZnF_C2H2 651 673 4.79e-3 SMART
ZnF_C2H2 679 701 1.3e-4 SMART
ZnF_C2H2 707 729 5.5e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (64/64)
MGI Phenotype PHENOTYPE: Homozygous disruption of this locus does not result in an overt phenotype early in life. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik A G 8: 72,445,375 S209G probably benign Het
Aars T C 8: 111,045,528 L450P possibly damaging Het
Acsbg1 G A 9: 54,615,984 T453M probably benign Het
Aff3 A G 1: 38,181,661 S1100P possibly damaging Het
B4galt5 G A 2: 167,348,929 A35V probably benign Het
BC017158 C T 7: 128,290,614 R1H probably damaging Het
C1qtnf1 T C 11: 118,447,857 S118P probably benign Het
Ceacam20 A T 7: 19,971,703 E206D probably damaging Het
Celsr3 T C 9: 108,848,794 L3066P probably damaging Het
Cers3 T G 7: 66,789,638 L299R probably damaging Het
Cfhr2 G T 1: 139,810,958 H288Q probably benign Het
Cnot1 A T 8: 95,769,844 M278K probably benign Het
Cnot10 T C 9: 114,627,469 E166G probably damaging Het
Ctsd T A 7: 142,385,460 D76V probably damaging Het
Cyp1a1 T A 9: 57,702,720 F472L probably damaging Het
Dupd1 A T 14: 21,702,882 D65E probably damaging Het
Dusp19 T A 2: 80,624,291 D118E probably damaging Het
Eif2ak3 C A 6: 70,878,919 R236S probably damaging Het
Fam169a A G 13: 97,122,752 T439A probably benign Het
Flg T C 3: 93,284,332 Y11H unknown Het
Fn1 T A 1: 71,628,459 I792L probably benign Het
Fzd7 T C 1: 59,483,083 S42P probably benign Het
Gimap3 A G 6: 48,765,436 S187P possibly damaging Het
Gli1 C A 10: 127,331,608 R592L probably damaging Het
Glt8d2 A T 10: 82,662,203 I124N probably damaging Het
Hbp1 C T 12: 31,933,388 D356N probably damaging Het
Hif1a T C 12: 73,939,599 S367P probably benign Het
Hspg2 C G 4: 137,518,979 P1023A possibly damaging Het
Itpr1 C A 6: 108,388,229 N880K probably benign Het
Kank1 T C 19: 25,378,478 probably benign Het
Kat2a T C 11: 100,712,290 T39A unknown Het
Kcnk2 T A 1: 189,339,849 Q98L probably benign Het
Kcnn4 G A 7: 24,384,120 G409S probably benign Het
Klrb1 T A 6: 128,713,613 I49F probably damaging Het
Larp4 G A 15: 100,010,356 V573I probably benign Het
Lrpprc A G 17: 84,740,068 probably null Het
Mybl1 A G 1: 9,676,281 S385P probably damaging Het
Nup62 T C 7: 44,829,016 S152P possibly damaging Het
Olfr96 A G 17: 37,225,350 Y75C probably damaging Het
Pcdh12 G A 18: 38,281,577 Q832* probably null Het
Pcid2 A G 8: 13,078,555 I368T probably damaging Het
Pcnx4 T A 12: 72,556,663 F492I probably damaging Het
Pi4ka A G 16: 17,357,573 Y464H Het
Plekhg5 T G 4: 152,104,744 S260R possibly damaging Het
Prkdc T A 16: 15,714,141 probably benign Het
Prr14 A T 7: 127,473,827 E115D probably benign Het
Rab3gap2 A T 1: 185,246,680 N285Y probably benign Het
Rhot1 T A 11: 80,257,560 C609S possibly damaging Het
Rnf123 T C 9: 108,068,507 Q360R probably benign Het
Rnf219 A T 14: 104,479,655 D427E probably damaging Het
Rrp12 T C 19: 41,880,219 T562A probably benign Het
Rundc1 G A 11: 101,432,166 G317D probably benign Het
Slc14a1 A T 18: 78,102,441 I426N possibly damaging Het
Slc23a1 C T 18: 35,622,535 G436E probably damaging Het
Slc45a3 A G 1: 131,977,785 D182G probably damaging Het
Sos1 A T 17: 80,408,299 F1010I probably damaging Het
Tap1 A G 17: 34,193,189 E456G probably damaging Het
Tha1 A T 11: 117,868,667 V332E probably damaging Het
Tmem18 T A 12: 30,588,518 I93N probably damaging Het
Tnrc18 A G 5: 142,726,012 F2664S probably damaging Het
Tpm3 T A 3: 90,073,704 probably benign Het
Ttc3 A G 16: 94,454,492 E1615G probably damaging Het
Ube3b A G 5: 114,402,686 T485A probably benign Het
Vmn2r92 A G 17: 18,166,624 Y75C probably damaging Het
Other mutations in Zfp169
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01925:Zfp169 APN 13 48490763 unclassified probably benign
IGL03329:Zfp169 APN 13 48490794 unclassified probably benign
IGL03382:Zfp169 APN 13 48491163 unclassified probably benign
IGL03394:Zfp169 APN 13 48489924 missense possibly damaging 0.93
BB010:Zfp169 UTSW 13 48490481 missense unknown
BB020:Zfp169 UTSW 13 48490481 missense unknown
R0571:Zfp169 UTSW 13 48489690 missense possibly damaging 0.71
R1714:Zfp169 UTSW 13 48498854 missense probably benign 0.35
R1784:Zfp169 UTSW 13 48489819 missense possibly damaging 0.61
R3108:Zfp169 UTSW 13 48489996 missense possibly damaging 0.86
R3689:Zfp169 UTSW 13 48506901 splice site probably benign
R4444:Zfp169 UTSW 13 48490337 missense possibly damaging 0.94
R4665:Zfp169 UTSW 13 48490863 unclassified probably benign
R4719:Zfp169 UTSW 13 48490158 missense probably benign 0.06
R4745:Zfp169 UTSW 13 48490232 missense possibly damaging 0.71
R5288:Zfp169 UTSW 13 48490275 missense possibly damaging 0.61
R5384:Zfp169 UTSW 13 48490275 missense possibly damaging 0.61
R5979:Zfp169 UTSW 13 48491040 unclassified probably benign
R6053:Zfp169 UTSW 13 48498858 missense probably damaging 1.00
R6823:Zfp169 UTSW 13 48490996 unclassified probably benign
R7084:Zfp169 UTSW 13 48498863 missense probably benign 0.10
R7679:Zfp169 UTSW 13 48498383 missense probably damaging 0.99
R7933:Zfp169 UTSW 13 48490481 missense unknown
R8298:Zfp169 UTSW 13 48498377 nonsense probably null
R9047:Zfp169 UTSW 13 48498816 missense probably damaging 1.00
R9124:Zfp169 UTSW 13 48491081 missense unknown
R9126:Zfp169 UTSW 13 48491081 missense unknown
R9131:Zfp169 UTSW 13 48491081 missense unknown
R9132:Zfp169 UTSW 13 48491081 missense unknown
Predicted Primers PCR Primer
(F):5'- CGAGTAAGGCTTCTCCACTC -3'
(R):5'- AGGGAGCAACTTCCAGTCAG -3'

Sequencing Primer
(F):5'- AGCTTCATGAGGTCAGAACTCTG -3'
(R):5'- TTCCAGTCAGAAGCTCCAGG -3'
Posted On 2020-07-28