Incidental Mutation 'R8322:Fam169a'
ID 642037
Institutional Source Beutler Lab
Gene Symbol Fam169a
Ensembl Gene ENSMUSG00000041817
Gene Name family with sequence similarity 169, member A
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.103) question?
Stock # R8322 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 97067286-97131013 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 97122752 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 439 (T439A)
Ref Sequence ENSEMBL: ENSMUSP00000043738 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042517] [ENSMUST00000169863]
AlphaFold Q5XG69
Predicted Effect probably benign
Transcript: ENSMUST00000042517
AA Change: T439A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000043738
Gene: ENSMUSG00000041817
AA Change: T439A

DomainStartEndE-ValueType
low complexity region 374 386 N/A INTRINSIC
low complexity region 602 619 N/A INTRINSIC
low complexity region 630 642 N/A INTRINSIC
low complexity region 650 663 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169863
AA Change: T439A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000126209
Gene: ENSMUSG00000041817
AA Change: T439A

DomainStartEndE-ValueType
low complexity region 374 386 N/A INTRINSIC
low complexity region 602 619 N/A INTRINSIC
low complexity region 630 642 N/A INTRINSIC
low complexity region 650 663 N/A INTRINSIC
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (64/64)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik A G 8: 72,445,375 S209G probably benign Het
Aars T C 8: 111,045,528 L450P possibly damaging Het
Acsbg1 G A 9: 54,615,984 T453M probably benign Het
Aff3 A G 1: 38,181,661 S1100P possibly damaging Het
B4galt5 G A 2: 167,348,929 A35V probably benign Het
BC017158 C T 7: 128,290,614 R1H probably damaging Het
C1qtnf1 T C 11: 118,447,857 S118P probably benign Het
Ceacam20 A T 7: 19,971,703 E206D probably damaging Het
Celsr3 T C 9: 108,848,794 L3066P probably damaging Het
Cers3 T G 7: 66,789,638 L299R probably damaging Het
Cfhr2 G T 1: 139,810,958 H288Q probably benign Het
Cnot1 A T 8: 95,769,844 M278K probably benign Het
Cnot10 T C 9: 114,627,469 E166G probably damaging Het
Ctsd T A 7: 142,385,460 D76V probably damaging Het
Cyp1a1 T A 9: 57,702,720 F472L probably damaging Het
Dupd1 A T 14: 21,702,882 D65E probably damaging Het
Dusp19 T A 2: 80,624,291 D118E probably damaging Het
Eif2ak3 C A 6: 70,878,919 R236S probably damaging Het
Flg T C 3: 93,284,332 Y11H unknown Het
Fn1 T A 1: 71,628,459 I792L probably benign Het
Fzd7 T C 1: 59,483,083 S42P probably benign Het
Gimap3 A G 6: 48,765,436 S187P possibly damaging Het
Gli1 C A 10: 127,331,608 R592L probably damaging Het
Glt8d2 A T 10: 82,662,203 I124N probably damaging Het
Hbp1 C T 12: 31,933,388 D356N probably damaging Het
Hif1a T C 12: 73,939,599 S367P probably benign Het
Hspg2 C G 4: 137,518,979 P1023A possibly damaging Het
Itpr1 C A 6: 108,388,229 N880K probably benign Het
Kank1 T C 19: 25,378,478 probably benign Het
Kat2a T C 11: 100,712,290 T39A unknown Het
Kcnk2 T A 1: 189,339,849 Q98L probably benign Het
Kcnn4 G A 7: 24,384,120 G409S probably benign Het
Klrb1 T A 6: 128,713,613 I49F probably damaging Het
Larp4 G A 15: 100,010,356 V573I probably benign Het
Lrpprc A G 17: 84,740,068 probably null Het
Mybl1 A G 1: 9,676,281 S385P probably damaging Het
Nup62 T C 7: 44,829,016 S152P possibly damaging Het
Olfr96 A G 17: 37,225,350 Y75C probably damaging Het
Pcdh12 G A 18: 38,281,577 Q832* probably null Het
Pcid2 A G 8: 13,078,555 I368T probably damaging Het
Pcnx4 T A 12: 72,556,663 F492I probably damaging Het
Pi4ka A G 16: 17,357,573 Y464H Het
Plekhg5 T G 4: 152,104,744 S260R possibly damaging Het
Prkdc T A 16: 15,714,141 probably benign Het
Prr14 A T 7: 127,473,827 E115D probably benign Het
Rab3gap2 A T 1: 185,246,680 N285Y probably benign Het
Rhot1 T A 11: 80,257,560 C609S possibly damaging Het
Rnf123 T C 9: 108,068,507 Q360R probably benign Het
Rnf219 A T 14: 104,479,655 D427E probably damaging Het
Rrp12 T C 19: 41,880,219 T562A probably benign Het
Rundc1 G A 11: 101,432,166 G317D probably benign Het
Slc14a1 A T 18: 78,102,441 I426N possibly damaging Het
Slc23a1 C T 18: 35,622,535 G436E probably damaging Het
Slc45a3 A G 1: 131,977,785 D182G probably damaging Het
Sos1 A T 17: 80,408,299 F1010I probably damaging Het
Tap1 A G 17: 34,193,189 E456G probably damaging Het
Tha1 A T 11: 117,868,667 V332E probably damaging Het
Tmem18 T A 12: 30,588,518 I93N probably damaging Het
Tnrc18 A G 5: 142,726,012 F2664S probably damaging Het
Tpm3 T A 3: 90,073,704 probably benign Het
Ttc3 A G 16: 94,454,492 E1615G probably damaging Het
Ube3b A G 5: 114,402,686 T485A probably benign Het
Vmn2r92 A G 17: 18,166,624 Y75C probably damaging Het
Zfp169 T C 13: 48,491,099 D184G unknown Het
Other mutations in Fam169a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01325:Fam169a APN 13 97122699 missense probably benign 0.00
IGL01380:Fam169a APN 13 97091951 missense probably damaging 0.97
IGL01761:Fam169a APN 13 97091918 missense possibly damaging 0.92
IGL02628:Fam169a APN 13 97111288 splice site probably benign
IGL02739:Fam169a APN 13 97094055 splice site probably benign
IGL03171:Fam169a APN 13 97110014 splice site probably benign
IGL03306:Fam169a APN 13 97106989 missense possibly damaging 0.66
IGL03377:Fam169a APN 13 97091873 missense probably benign 0.04
IGL02980:Fam169a UTSW 13 97113680 critical splice donor site probably null
R0282:Fam169a UTSW 13 97097715 splice site probably benign
R1319:Fam169a UTSW 13 97097562 missense probably damaging 1.00
R1468:Fam169a UTSW 13 97118530 missense probably benign 0.01
R1468:Fam169a UTSW 13 97118530 missense probably benign 0.01
R2037:Fam169a UTSW 13 97107092 missense probably benign 0.37
R2380:Fam169a UTSW 13 97118535 splice site probably benign
R3805:Fam169a UTSW 13 97097684 missense probably benign 0.00
R4434:Fam169a UTSW 13 97126740 missense probably damaging 1.00
R4435:Fam169a UTSW 13 97126740 missense probably damaging 1.00
R4437:Fam169a UTSW 13 97126740 missense probably damaging 1.00
R4590:Fam169a UTSW 13 97097585 missense probably benign 0.02
R4896:Fam169a UTSW 13 97097592 missense probably damaging 1.00
R5004:Fam169a UTSW 13 97097592 missense probably damaging 1.00
R5276:Fam169a UTSW 13 97118496 missense probably benign 0.01
R5370:Fam169a UTSW 13 97106962 missense probably damaging 1.00
R5687:Fam169a UTSW 13 97093618 missense probably damaging 1.00
R6151:Fam169a UTSW 13 97093630 missense probably damaging 1.00
R7711:Fam169a UTSW 13 97126688 nonsense probably null
R8493:Fam169a UTSW 13 97122859 missense probably benign 0.00
R8698:Fam169a UTSW 13 97107070 missense probably damaging 1.00
R8794:Fam169a UTSW 13 97114120 missense possibly damaging 0.85
R9231:Fam169a UTSW 13 97118459 missense probably benign 0.08
R9479:Fam169a UTSW 13 97110035 missense possibly damaging 0.68
R9479:Fam169a UTSW 13 97114187 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TCTGACACTGAAGGTCCTCC -3'
(R):5'- CACCAACAGGCAAATTCTACTGTG -3'

Sequencing Primer
(F):5'- GCCCCGAGGAAATCTAAAATCTAAG -3'
(R):5'- TCTACTGTGAAAAGTGAGGCAATACC -3'
Posted On 2020-07-28