Mutagenetix > Incidental Mutation

Incidental Mutation 'R8322:Slc23a1'

642048

Institutional Source

Beutler Lab

Gene Symbol

Slc23a1

Ensembl Gene

ENSMUSG00000024354

Gene Name

solute carrier family 23 (nucleobase transporters), member 1

Synonyms

Slc23a2, YSPL3, D18Ucla2, SVCT1

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.134) question?

Stock #

R8322 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

35614604-35627244 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 35622535 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Glutamic Acid at position 436 (G436E)

Ref Sequence

ENSEMBL: ENSMUSP00000025212 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025212] [ENSMUST00000150877]

AlphaFold

Q9Z2J0

Predicted Effect

probably damaging
Transcript: ENSMUST00000025212
AA Change: G436E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000025212
Gene: ENSMUSG00000024354
AA Change: G436E

Domain	Start	End	E-Value	Type
Pfam:Xan_ur_permease	50	484	4.9e-91	PFAM
transmembrane domain	496	518	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000150877

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (64/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The absorption of vitamin C into the body and its distribution to organs requires two sodium-dependent vitamin C transporters. This gene encodes one of the two transporters. The encoded protein is active in bulk vitamin C transport involving epithelial surfaces. Previously, this gene had an official symbol of SLC23A2. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal ascorbate homeostasis and early postnatal lethality associated with lethargy and lack of gastric milk. Heterozygous mice of homozgous dams exhibit a similar phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700030K09Rik	A	G	8: 72,445,375	S209G	probably benign	Het
Aars	T	C	8: 111,045,528	L450P	possibly damaging	Het
Acsbg1	G	A	9: 54,615,984	T453M	probably benign	Het
Aff3	A	G	1: 38,181,661	S1100P	possibly damaging	Het
B4galt5	G	A	2: 167,348,929	A35V	probably benign	Het
BC017158	C	T	7: 128,290,614	R1H	probably damaging	Het
C1qtnf1	T	C	11: 118,447,857	S118P	probably benign	Het
Ceacam20	A	T	7: 19,971,703	E206D	probably damaging	Het
Celsr3	T	C	9: 108,848,794	L3066P	probably damaging	Het
Cers3	T	G	7: 66,789,638	L299R	probably damaging	Het
Cfhr2	G	T	1: 139,810,958	H288Q	probably benign	Het
Cnot1	A	T	8: 95,769,844	M278K	probably benign	Het
Cnot10	T	C	9: 114,627,469	E166G	probably damaging	Het
Ctsd	T	A	7: 142,385,460	D76V	probably damaging	Het
Cyp1a1	T	A	9: 57,702,720	F472L	probably damaging	Het
Dupd1	A	T	14: 21,702,882	D65E	probably damaging	Het
Dusp19	T	A	2: 80,624,291	D118E	probably damaging	Het
Eif2ak3	C	A	6: 70,878,919	R236S	probably damaging	Het
Fam169a	A	G	13: 97,122,752	T439A	probably benign	Het
Flg	T	C	3: 93,284,332	Y11H	unknown	Het
Fn1	T	A	1: 71,628,459	I792L	probably benign	Het
Fzd7	T	C	1: 59,483,083	S42P	probably benign	Het
Gimap3	A	G	6: 48,765,436	S187P	possibly damaging	Het
Gli1	C	A	10: 127,331,608	R592L	probably damaging	Het
Glt8d2	A	T	10: 82,662,203	I124N	probably damaging	Het
Hbp1	C	T	12: 31,933,388	D356N	probably damaging	Het
Hif1a	T	C	12: 73,939,599	S367P	probably benign	Het
Hspg2	C	G	4: 137,518,979	P1023A	possibly damaging	Het
Itpr1	C	A	6: 108,388,229	N880K	probably benign	Het
Kank1	T	C	19: 25,378,478		probably benign	Het
Kat2a	T	C	11: 100,712,290	T39A	unknown	Het
Kcnk2	T	A	1: 189,339,849	Q98L	probably benign	Het
Kcnn4	G	A	7: 24,384,120	G409S	probably benign	Het
Klrb1	T	A	6: 128,713,613	I49F	probably damaging	Het
Larp4	G	A	15: 100,010,356	V573I	probably benign	Het
Lrpprc	A	G	17: 84,740,068		probably null	Het
Mybl1	A	G	1: 9,676,281	S385P	probably damaging	Het
Nup62	T	C	7: 44,829,016	S152P	possibly damaging	Het
Olfr96	A	G	17: 37,225,350	Y75C	probably damaging	Het
Pcdh12	G	A	18: 38,281,577	Q832*	probably null	Het
Pcid2	A	G	8: 13,078,555	I368T	probably damaging	Het
Pcnx4	T	A	12: 72,556,663	F492I	probably damaging	Het
Pi4ka	A	G	16: 17,357,573	Y464H		Het
Plekhg5	T	G	4: 152,104,744	S260R	possibly damaging	Het
Prkdc	T	A	16: 15,714,141		probably benign	Het
Prr14	A	T	7: 127,473,827	E115D	probably benign	Het
Rab3gap2	A	T	1: 185,246,680	N285Y	probably benign	Het
Rhot1	T	A	11: 80,257,560	C609S	possibly damaging	Het
Rnf123	T	C	9: 108,068,507	Q360R	probably benign	Het
Rnf219	A	T	14: 104,479,655	D427E	probably damaging	Het
Rrp12	T	C	19: 41,880,219	T562A	probably benign	Het
Rundc1	G	A	11: 101,432,166	G317D	probably benign	Het
Slc14a1	A	T	18: 78,102,441	I426N	possibly damaging	Het
Slc45a3	A	G	1: 131,977,785	D182G	probably damaging	Het
Sos1	A	T	17: 80,408,299	F1010I	probably damaging	Het
Tap1	A	G	17: 34,193,189	E456G	probably damaging	Het
Tha1	A	T	11: 117,868,667	V332E	probably damaging	Het
Tmem18	T	A	12: 30,588,518	I93N	probably damaging	Het
Tnrc18	A	G	5: 142,726,012	F2664S	probably damaging	Het
Tpm3	T	A	3: 90,073,704		probably benign	Het
Ttc3	A	G	16: 94,454,492	E1615G	probably damaging	Het
Ube3b	A	G	5: 114,402,686	T485A	probably benign	Het
Vmn2r92	A	G	17: 18,166,624	Y75C	probably damaging	Het
Zfp169	T	C	13: 48,491,099	D184G	unknown	Het

Other mutations in Slc23a1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01825:Slc23a1	APN	18	35624203	missense	probably damaging	1.00
IGL01969:Slc23a1	APN	18	35624754	missense	possibly damaging	0.93
R0360:Slc23a1	UTSW	18	35622979	splice site	probably benign
R1296:Slc23a1	UTSW	18	35622623	missense	possibly damaging	0.88
R1720:Slc23a1	UTSW	18	35625851	missense	possibly damaging	0.95
R2107:Slc23a1	UTSW	18	35625826	missense	possibly damaging	0.89
R2140:Slc23a1	UTSW	18	35626434	missense	unknown
R4694:Slc23a1	UTSW	18	35619580	missense	probably damaging	0.99
R5298:Slc23a1	UTSW	18	35622510	critical splice donor site	probably null
R5593:Slc23a1	UTSW	18	35622296	missense	probably damaging	1.00
R5629:Slc23a1	UTSW	18	35626492	missense	probably benign	0.00
R5842:Slc23a1	UTSW	18	35622882	missense	probably damaging	0.99
R6229:Slc23a1	UTSW	18	35619524	missense	probably benign	0.08
R6233:Slc23a1	UTSW	18	35624444	missense	probably damaging	1.00
R6268:Slc23a1	UTSW	18	35619571	missense	probably damaging	1.00
R6552:Slc23a1	UTSW	18	35622338	missense	probably damaging	1.00
R6966:Slc23a1	UTSW	18	35625061	missense	probably damaging	1.00
R7070:Slc23a1	UTSW	18	35621781	missense	probably damaging	1.00
R7586:Slc23a1	UTSW	18	35625838	missense	probably damaging	0.99
R7849:Slc23a1	UTSW	18	35624501	missense	probably benign	0.00
R7884:Slc23a1	UTSW	18	35625949	missense	possibly damaging	0.79
R8324:Slc23a1	UTSW	18	35622535	missense	probably damaging	1.00
R8341:Slc23a1	UTSW	18	35622535	missense	probably damaging	1.00
R8342:Slc23a1	UTSW	18	35622535	missense	probably damaging	1.00
R8444:Slc23a1	UTSW	18	35624436	missense	possibly damaging	0.95
R8753:Slc23a1	UTSW	18	35619578	missense	probably benign	0.01
R9763:Slc23a1	UTSW	18	35622311	missense	probably damaging	0.98
X0065:Slc23a1	UTSW	18	35626359	missense	unknown
Z1088:Slc23a1	UTSW	18	35624508	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TCCCAATACAAAGAGGTTGCG -3'
(R):5'- TGAGAGCATCCCACCTTTATCC -3'

Sequencing Primer
(F):5'- TTGCGAGAAGAGTTCATGTCCAC -3'
(R):5'- GGAGTCCATTTATTCACCTAATACC -3'

Posted On

2020-07-28