Incidental Mutation 'R8322:Pcdh12'
ID642049
Institutional Source Beutler Lab
Gene Symbol Pcdh12
Ensembl Gene ENSMUSG00000024440
Gene Nameprotocadherin 12
SynonymsVE-cadherin-2, vascular endothelial cadherin-2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8322 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location38267092-38284402 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 38281577 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 832 (Q832*)
Ref Sequence ENSEMBL: ENSMUSP00000025311 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025311] [ENSMUST00000194012]
Predicted Effect probably null
Transcript: ENSMUST00000025311
AA Change: Q832*
SMART Domains Protein: ENSMUSP00000025311
Gene: ENSMUSG00000024440
AA Change: Q832*

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
CA 53 133 4.42e-2 SMART
CA 157 242 2.55e-17 SMART
CA 266 350 2.31e-24 SMART
CA 376 458 3.86e-26 SMART
CA 482 563 6.27e-26 SMART
CA 621 704 3.02e-2 SMART
transmembrane domain 716 738 N/A INTRINSIC
low complexity region 960 975 N/A INTRINSIC
low complexity region 1032 1041 N/A INTRINSIC
low complexity region 1115 1125 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194012
SMART Domains Protein: ENSMUSP00000141907
Gene: ENSMUSG00000024440

DomainStartEndE-ValueType
low complexity region 56 66 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the protocadherin gene family, a subfamily of the cadherin superfamily. The encoded protein consists of an extracellular domain containing 6 cadherin repeats, a transmembrane domain and a cytoplasmic tail that differs from those of the classical cadherins. The gene localizes to the region on chromosome 5 where the protocadherin gene clusters reside. The exon organization of this transcript is similar to that of the gene cluster transcripts, notably the first large exon, but no significant sequence homology exists. The function of this cellular adhesion protein is undetermined but mouse protocadherin 12 does not bind catenins and appears to have no affect on cell migration or growth. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation are viable, fertile and do not display any obvious histomorphological abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik A G 8: 72,445,375 S209G probably benign Het
Aars T C 8: 111,045,528 L450P possibly damaging Het
Acsbg1 G A 9: 54,615,984 T453M probably benign Het
Aff3 A G 1: 38,181,661 S1100P possibly damaging Het
B4galt5 G A 2: 167,348,929 A35V probably benign Het
BC017158 C T 7: 128,290,614 R1H probably damaging Het
C1qtnf1 T C 11: 118,447,857 S118P probably benign Het
Ceacam20 A T 7: 19,971,703 E206D probably damaging Het
Celsr3 T C 9: 108,848,794 L3066P probably damaging Het
Cers3 T G 7: 66,789,638 L299R probably damaging Het
Cfhr2 G T 1: 139,810,958 H288Q probably benign Het
Cnot1 A T 8: 95,769,844 M278K probably benign Het
Cnot10 T C 9: 114,627,469 E166G probably damaging Het
Ctsd T A 7: 142,385,460 D76V probably damaging Het
Cyp1a1 T A 9: 57,702,720 F472L probably damaging Het
Dupd1 A T 14: 21,702,882 D65E probably damaging Het
Dusp19 T A 2: 80,624,291 D118E probably damaging Het
Eif2ak3 C A 6: 70,878,919 R236S probably damaging Het
Fam169a A G 13: 97,122,752 T439A probably benign Het
Flg T C 3: 93,284,332 Y11H unknown Het
Fn1 T A 1: 71,628,459 I792L probably benign Het
Fzd7 T C 1: 59,483,083 S42P probably benign Het
Gimap3 A G 6: 48,765,436 S187P possibly damaging Het
Gli1 C A 10: 127,331,608 R592L probably damaging Het
Glt8d2 A T 10: 82,662,203 I124N probably damaging Het
Hbp1 C T 12: 31,933,388 D356N probably damaging Het
Hif1a T C 12: 73,939,599 S367P probably benign Het
Hspg2 C G 4: 137,518,979 P1023A possibly damaging Het
Itpr1 C A 6: 108,388,229 N880K probably benign Het
Kank1 T C 19: 25,378,478 probably benign Het
Kat2a T C 11: 100,712,290 T39A unknown Het
Kcnk2 T A 1: 189,339,849 Q98L probably benign Het
Kcnn4 G A 7: 24,384,120 G409S probably benign Het
Klrb1 T A 6: 128,713,613 I49F probably damaging Het
Larp4 G A 15: 100,010,356 V573I probably benign Het
Lrpprc A G 17: 84,740,068 probably null Het
Mybl1 A G 1: 9,676,281 S385P probably damaging Het
Nup62 T C 7: 44,829,016 S152P possibly damaging Het
Olfr96 A G 17: 37,225,350 Y75C probably damaging Het
Pcid2 A G 8: 13,078,555 I368T probably damaging Het
Pcnx4 T A 12: 72,556,663 F492I probably damaging Het
Pi4ka A G 16: 17,357,573 Y464H Het
Plekhg5 T G 4: 152,104,744 S260R possibly damaging Het
Prkdc T A 16: 15,714,141 probably benign Het
Prr14 A T 7: 127,473,827 E115D probably benign Het
Rab3gap2 A T 1: 185,246,680 N285Y probably benign Het
Rhot1 T A 11: 80,257,560 C609S possibly damaging Het
Rnf123 T C 9: 108,068,507 Q360R probably benign Het
Rnf219 A T 14: 104,479,655 D427E probably damaging Het
Rrp12 T C 19: 41,880,219 T562A probably benign Het
Rundc1 G A 11: 101,432,166 G317D probably benign Het
Slc14a1 A T 18: 78,102,441 I426N possibly damaging Het
Slc23a1 C T 18: 35,622,535 G436E probably damaging Het
Slc45a3 A G 1: 131,977,785 D182G probably damaging Het
Sos1 A T 17: 80,408,299 F1010I probably damaging Het
Tap1 A G 17: 34,193,189 E456G probably damaging Het
Tha1 A T 11: 117,868,667 V332E probably damaging Het
Tmem18 T A 12: 30,588,518 I93N probably damaging Het
Tnrc18 A G 5: 142,726,012 F2664S probably damaging Het
Tpm3 T A 3: 90,073,704 probably benign Het
Ttc3 A G 16: 94,454,492 E1615G probably damaging Het
Ube3b A G 5: 114,402,686 T485A probably benign Het
Vmn2r92 A G 17: 18,166,624 Y75C probably damaging Het
Zfp169 T C 13: 48,491,099 D184G unknown Het
Other mutations in Pcdh12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Pcdh12 APN 18 38281457 missense probably benign
IGL00964:Pcdh12 APN 18 38282731 missense probably benign 0.27
IGL01105:Pcdh12 APN 18 38275347 missense probably damaging 1.00
IGL02011:Pcdh12 APN 18 38281420 missense probably damaging 1.00
IGL02234:Pcdh12 APN 18 38283535 missense probably damaging 1.00
IGL02452:Pcdh12 APN 18 38281693 missense probably benign 0.00
IGL03412:Pcdh12 APN 18 38283515 missense probably benign 0.24
R0729:Pcdh12 UTSW 18 38282464 missense probably benign 0.20
R1330:Pcdh12 UTSW 18 38281861 missense probably benign 0.13
R1394:Pcdh12 UTSW 18 38281189 critical splice donor site probably null
R1413:Pcdh12 UTSW 18 38283443 missense probably damaging 1.00
R1993:Pcdh12 UTSW 18 38282143 missense possibly damaging 0.62
R2115:Pcdh12 UTSW 18 38283986 missense probably damaging 1.00
R2567:Pcdh12 UTSW 18 38282096 missense probably damaging 1.00
R2926:Pcdh12 UTSW 18 38282390 missense probably damaging 0.99
R3810:Pcdh12 UTSW 18 38281237 missense probably damaging 1.00
R3813:Pcdh12 UTSW 18 38283614 nonsense probably null
R5275:Pcdh12 UTSW 18 38284101 utr 5 prime probably benign
R5400:Pcdh12 UTSW 18 38268898 missense probably damaging 1.00
R5523:Pcdh12 UTSW 18 38283139 missense probably damaging 1.00
R5539:Pcdh12 UTSW 18 38281744 missense possibly damaging 0.77
R5604:Pcdh12 UTSW 18 38268882 missense probably damaging 1.00
R6012:Pcdh12 UTSW 18 38283752 missense probably damaging 1.00
R6042:Pcdh12 UTSW 18 38281505 missense probably damaging 1.00
R6129:Pcdh12 UTSW 18 38277859 missense probably damaging 1.00
R6239:Pcdh12 UTSW 18 38282401 missense probably damaging 1.00
R6508:Pcdh12 UTSW 18 38281337 nonsense probably null
R7250:Pcdh12 UTSW 18 38281976 missense probably benign
R7259:Pcdh12 UTSW 18 38281624 missense probably benign 0.00
R7271:Pcdh12 UTSW 18 38283047 missense probably damaging 1.00
R7489:Pcdh12 UTSW 18 38281789 missense possibly damaging 0.77
R8103:Pcdh12 UTSW 18 38282159 missense probably damaging 1.00
R8157:Pcdh12 UTSW 18 38282797 missense probably benign
R8503:Pcdh12 UTSW 18 38282521 missense possibly damaging 0.86
R8510:Pcdh12 UTSW 18 38282056 missense possibly damaging 0.89
Z1177:Pcdh12 UTSW 18 38282992 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCTTAGGGTTGCAGAGGACG -3'
(R):5'- GAAGGCAGATATCCACCTGG -3'

Sequencing Primer
(F):5'- TGCAGAGGACGCTGGTG -3'
(R):5'- AGATATCCACCTGGTGCCTGTG -3'
Posted On2020-07-28