Mutagenetix > Incidental Mutation

Incidental Mutation 'R8322:Kank1'

642051

Institutional Source

Beutler Lab

Gene Symbol

Kank1

Ensembl Gene

ENSMUSG00000032702

Gene Name

KN motif and ankyrin repeat domains 1

Synonyms

D330024H06Rik, Ankrd15, A930031B09Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8322 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

25236975-25434496 bp(+) (GRCm38)

Type of Mutation

start gained

DNA Base Change (assembly)

T to C at 25378478 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000042177 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049400]

AlphaFold

E9Q238

Predicted Effect

probably benign
Transcript: ENSMUST00000049400

SMART Domains

Protein: ENSMUSP00000042177
Gene: ENSMUSG00000032702

Domain	Start	End	E-Value	Type
Pfam:KN_motif	30	68	3.3e-24	PFAM
low complexity region	88	105	N/A	INTRINSIC
low complexity region	138	148	N/A	INTRINSIC
coiled coil region	286	314	N/A	INTRINSIC
low complexity region	350	358	N/A	INTRINSIC
coiled coil region	362	395	N/A	INTRINSIC
coiled coil region	451	494	N/A	INTRINSIC
low complexity region	541	556	N/A	INTRINSIC
low complexity region	617	629	N/A	INTRINSIC
Blast:ANK	963	993	7e-10	BLAST
low complexity region	1010	1030	N/A	INTRINSIC
low complexity region	1074	1095	N/A	INTRINSIC
ANK	1169	1199	3.71e-4	SMART
ANK	1203	1236	2.27e1	SMART
ANK	1241	1270	1.33e-5	SMART
ANK	1274	1306	5.84e-2	SMART
ANK	1308	1336	4.86e1	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (64/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the Kank family of proteins, which contain multiple ankyrin repeat domains. This family member functions in cytoskeleton formation by regulating actin polymerization. This gene is a candidate tumor suppressor for renal cell carcinoma. Mutations in this gene cause cerebral palsy spastic quadriplegic type 2, a central nervous system development disorder. A t(5;9) translocation results in fusion of the platelet-derived growth factor receptor beta gene (PDGFRB) on chromosome 5 with this gene in a myeloproliferative neoplasm featuring severe thrombocythemia. Alternative splicing of this gene results in multiple transcript variants. A related pseudogene has been identified on chromosome 20. [provided by RefSeq, Dec 2014]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700030K09Rik	A	G	8: 72,445,375	S209G	probably benign	Het
Aars	T	C	8: 111,045,528	L450P	possibly damaging	Het
Acsbg1	G	A	9: 54,615,984	T453M	probably benign	Het
Aff3	A	G	1: 38,181,661	S1100P	possibly damaging	Het
B4galt5	G	A	2: 167,348,929	A35V	probably benign	Het
BC017158	C	T	7: 128,290,614	R1H	probably damaging	Het
C1qtnf1	T	C	11: 118,447,857	S118P	probably benign	Het
Ceacam20	A	T	7: 19,971,703	E206D	probably damaging	Het
Celsr3	T	C	9: 108,848,794	L3066P	probably damaging	Het
Cers3	T	G	7: 66,789,638	L299R	probably damaging	Het
Cfhr2	G	T	1: 139,810,958	H288Q	probably benign	Het
Cnot1	A	T	8: 95,769,844	M278K	probably benign	Het
Cnot10	T	C	9: 114,627,469	E166G	probably damaging	Het
Ctsd	T	A	7: 142,385,460	D76V	probably damaging	Het
Cyp1a1	T	A	9: 57,702,720	F472L	probably damaging	Het
Dupd1	A	T	14: 21,702,882	D65E	probably damaging	Het
Dusp19	T	A	2: 80,624,291	D118E	probably damaging	Het
Eif2ak3	C	A	6: 70,878,919	R236S	probably damaging	Het
Fam169a	A	G	13: 97,122,752	T439A	probably benign	Het
Flg	T	C	3: 93,284,332	Y11H	unknown	Het
Fn1	T	A	1: 71,628,459	I792L	probably benign	Het
Fzd7	T	C	1: 59,483,083	S42P	probably benign	Het
Gimap3	A	G	6: 48,765,436	S187P	possibly damaging	Het
Gli1	C	A	10: 127,331,608	R592L	probably damaging	Het
Glt8d2	A	T	10: 82,662,203	I124N	probably damaging	Het
Hbp1	C	T	12: 31,933,388	D356N	probably damaging	Het
Hif1a	T	C	12: 73,939,599	S367P	probably benign	Het
Hspg2	C	G	4: 137,518,979	P1023A	possibly damaging	Het
Itpr1	C	A	6: 108,388,229	N880K	probably benign	Het
Kat2a	T	C	11: 100,712,290	T39A	unknown	Het
Kcnk2	T	A	1: 189,339,849	Q98L	probably benign	Het
Kcnn4	G	A	7: 24,384,120	G409S	probably benign	Het
Klrb1	T	A	6: 128,713,613	I49F	probably damaging	Het
Larp4	G	A	15: 100,010,356	V573I	probably benign	Het
Lrpprc	A	G	17: 84,740,068		probably null	Het
Mybl1	A	G	1: 9,676,281	S385P	probably damaging	Het
Nup62	T	C	7: 44,829,016	S152P	possibly damaging	Het
Olfr96	A	G	17: 37,225,350	Y75C	probably damaging	Het
Pcdh12	G	A	18: 38,281,577	Q832*	probably null	Het
Pcid2	A	G	8: 13,078,555	I368T	probably damaging	Het
Pcnx4	T	A	12: 72,556,663	F492I	probably damaging	Het
Pi4ka	A	G	16: 17,357,573	Y464H		Het
Plekhg5	T	G	4: 152,104,744	S260R	possibly damaging	Het
Prkdc	T	A	16: 15,714,141		probably benign	Het
Prr14	A	T	7: 127,473,827	E115D	probably benign	Het
Rab3gap2	A	T	1: 185,246,680	N285Y	probably benign	Het
Rhot1	T	A	11: 80,257,560	C609S	possibly damaging	Het
Rnf123	T	C	9: 108,068,507	Q360R	probably benign	Het
Rnf219	A	T	14: 104,479,655	D427E	probably damaging	Het
Rrp12	T	C	19: 41,880,219	T562A	probably benign	Het
Rundc1	G	A	11: 101,432,166	G317D	probably benign	Het
Slc14a1	A	T	18: 78,102,441	I426N	possibly damaging	Het
Slc23a1	C	T	18: 35,622,535	G436E	probably damaging	Het
Slc45a3	A	G	1: 131,977,785	D182G	probably damaging	Het
Sos1	A	T	17: 80,408,299	F1010I	probably damaging	Het
Tap1	A	G	17: 34,193,189	E456G	probably damaging	Het
Tha1	A	T	11: 117,868,667	V332E	probably damaging	Het
Tmem18	T	A	12: 30,588,518	I93N	probably damaging	Het
Tnrc18	A	G	5: 142,726,012	F2664S	probably damaging	Het
Tpm3	T	A	3: 90,073,704		probably benign	Het
Ttc3	A	G	16: 94,454,492	E1615G	probably damaging	Het
Ube3b	A	G	5: 114,402,686	T485A	probably benign	Het
Vmn2r92	A	G	17: 18,166,624	Y75C	probably damaging	Het
Zfp169	T	C	13: 48,491,099	D184G	unknown	Het

Other mutations in Kank1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00324:Kank1	APN	19	25411758	missense	probably benign
IGL00435:Kank1	APN	19	25430236	missense	probably benign	0.41
IGL01105:Kank1	APN	19	25424316	missense	possibly damaging	0.80
IGL01974:Kank1	APN	19	25410232	missense	possibly damaging	0.87
IGL02031:Kank1	APN	19	25410702	missense	probably benign	0.01
IGL02125:Kank1	APN	19	25410703	missense	possibly damaging	0.90
IGL02152:Kank1	APN	19	25428172	missense	possibly damaging	0.51
IGL02211:Kank1	APN	19	25430338	missense	probably damaging	1.00
IGL02440:Kank1	APN	19	25432908	missense	probably damaging	1.00
IGL02448:Kank1	APN	19	25411375	missense	probably damaging	1.00
IGL02671:Kank1	APN	19	25428095	missense	probably damaging	1.00
IGL03102:Kank1	APN	19	25425918	missense	probably damaging	1.00
IGL03259:Kank1	APN	19	25430341	missense	probably damaging	1.00
IGL02802:Kank1	UTSW	19	25411599	missense	probably damaging	1.00
R0107:Kank1	UTSW	19	25430366	unclassified	probably benign
R0190:Kank1	UTSW	19	25409283	missense	probably benign	0.00
R0330:Kank1	UTSW	19	25424313	missense	probably benign	0.00
R0368:Kank1	UTSW	19	25410603	nonsense	probably null
R0399:Kank1	UTSW	19	25411242	missense	probably benign	0.00
R0426:Kank1	UTSW	19	25411473	missense	probably damaging	1.00
R0483:Kank1	UTSW	19	25425993	unclassified	probably benign
R1394:Kank1	UTSW	19	25428164	missense	probably damaging	1.00
R1495:Kank1	UTSW	19	25410349	missense	probably damaging	0.98
R1681:Kank1	UTSW	19	25410304	missense	possibly damaging	0.89
R1698:Kank1	UTSW	19	25411317	missense	probably benign	0.11
R1830:Kank1	UTSW	19	25411032	missense	probably benign	0.00
R1866:Kank1	UTSW	19	25411449	missense	probably benign	0.04
R2138:Kank1	UTSW	19	25411753	missense	probably benign	0.00
R2139:Kank1	UTSW	19	25411753	missense	probably benign	0.00
R2420:Kank1	UTSW	19	25410457	missense	probably damaging	1.00
R3153:Kank1	UTSW	19	25410688	missense	possibly damaging	0.89
R4164:Kank1	UTSW	19	25411072	missense	probably benign	0.10
R4670:Kank1	UTSW	19	25410580	missense	probably benign	0.00
R4685:Kank1	UTSW	19	25410034	missense	possibly damaging	0.66
R4843:Kank1	UTSW	19	25431007	missense	probably damaging	1.00
R4981:Kank1	UTSW	19	25411395	missense	probably benign	0.19
R5189:Kank1	UTSW	19	25424181	missense	probably damaging	1.00
R5280:Kank1	UTSW	19	25411305	missense	probably benign	0.01
R5330:Kank1	UTSW	19	25411329	missense	probably damaging	1.00
R5331:Kank1	UTSW	19	25411329	missense	probably damaging	1.00
R5435:Kank1	UTSW	19	25411143	missense	probably benign	0.04
R5500:Kank1	UTSW	19	25424332	missense	possibly damaging	0.46
R5894:Kank1	UTSW	19	25424200	missense	probably damaging	1.00
R6087:Kank1	UTSW	19	25409724	missense	probably benign	0.41
R6357:Kank1	UTSW	19	25411353	missense	probably benign	0.36
R6490:Kank1	UTSW	19	25410085	missense	probably damaging	1.00
R6504:Kank1	UTSW	19	25428154	missense	probably damaging	1.00
R6942:Kank1	UTSW	19	25424173	missense	possibly damaging	0.88
R7037:Kank1	UTSW	19	25430341	missense	probably damaging	1.00
R7405:Kank1	UTSW	19	25410319	nonsense	probably null
R7486:Kank1	UTSW	19	25410829	missense	probably damaging	0.99
R7602:Kank1	UTSW	19	25422161	missense	probably benign	0.01
R7701:Kank1	UTSW	19	25411765	critical splice donor site	probably null
R7765:Kank1	UTSW	19	25411205	frame shift	probably null
R7766:Kank1	UTSW	19	25411205	frame shift	probably null
R7768:Kank1	UTSW	19	25411205	frame shift	probably null
R7919:Kank1	UTSW	19	25431075	missense	probably damaging	1.00
R7974:Kank1	UTSW	19	25424220	missense	probably damaging	1.00
R7978:Kank1	UTSW	19	25411205	frame shift	probably null
R8017:Kank1	UTSW	19	25411204	frame shift	probably null
R8017:Kank1	UTSW	19	25411205	frame shift	probably null
R8020:Kank1	UTSW	19	25411205	frame shift	probably null
R8150:Kank1	UTSW	19	25410799	missense	possibly damaging	0.88
R8374:Kank1	UTSW	19	25411641	missense	probably damaging	0.97
R8705:Kank1	UTSW	19	25411543	missense	probably damaging	1.00
R8855:Kank1	UTSW	19	25411338	missense	possibly damaging	0.87
R8866:Kank1	UTSW	19	25411338	missense	possibly damaging	0.87
R8891:Kank1	UTSW	19	25410075	missense	probably benign	0.32
R8894:Kank1	UTSW	19	25431014	missense	probably damaging	1.00
R8917:Kank1	UTSW	19	25409564	missense	probably damaging	0.99
R9217:Kank1	UTSW	19	25409580	missense	possibly damaging	0.92
R9301:Kank1	UTSW	19	25411434	missense	probably benign	0.00
R9431:Kank1	UTSW	19	25410502	missense	probably damaging	1.00
R9603:Kank1	UTSW	19	25430925	missense	possibly damaging	0.95
R9680:Kank1	UTSW	19	25410774	missense	probably damaging	1.00
R9746:Kank1	UTSW	19	25409508	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTGGGTACGACATTCCTCTAGATAC -3'
(R):5'- TCGGAATTCTACTTCTCTAGGCTAC -3'

Sequencing Primer
(F):5'- ACTTTAGGACCAGGCTTCATGCAG -3'
(R):5'- TGAACTGAGACATCCCCT -3'

Posted On

2020-07-28