Incidental Mutation 'R0109:Prdx2'
ID64206
Institutional Source Beutler Lab
Gene Symbol Prdx2
Ensembl Gene ENSMUSG00000005161
Gene Nameperoxiredoxin 2
SynonymsTR, Tdpx1, PrxII, Prx II-1, TPx, TDX1, thioredoxin dependent peroxide reductase 1, TSA, thiol specific antioxidant protein, Trx dependent peroxide reductase 1, thioredoxin reductase, thioredoxin peroxidase, protector protein, PRP
MMRRC Submission 038395-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.917) question?
Stock #R0109 (G1)
Quality Score125
Status Not validated
Chromosome8
Chromosomal Location84969587-84974834 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 84970251 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 4 (G4S)
Ref Sequence ENSEMBL: ENSMUSP00000126451 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005292] [ENSMUST00000065049] [ENSMUST00000109733] [ENSMUST00000109734] [ENSMUST00000109736] [ENSMUST00000109738] [ENSMUST00000125893] [ENSMUST00000128972] [ENSMUST00000130902] [ENSMUST00000140561] [ENSMUST00000147812] [ENSMUST00000164807] [ENSMUST00000214133]
Predicted Effect probably benign
Transcript: ENSMUST00000005292
AA Change: G4S

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000005292
Gene: ENSMUSG00000005161
AA Change: G4S

DomainStartEndE-ValueType
Pfam:Redoxin 7 157 3.9e-20 PFAM
Pfam:AhpC-TSA 8 141 5.6e-44 PFAM
Pfam:1-cysPrx_C 161 196 8.6e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000065049
SMART Domains Protein: ENSMUSP00000066769
Gene: ENSMUSG00000052926

DomainStartEndE-ValueType
Pfam:RNase_HII 31 242 7.1e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109733
AA Change: G4S

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000105355
Gene: ENSMUSG00000005161
AA Change: G4S

DomainStartEndE-ValueType
Pfam:Redoxin 7 159 1.3e-21 PFAM
Pfam:AhpC-TSA 8 141 1.3e-44 PFAM
Pfam:1-cysPrx_C 161 196 8.6e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109734
AA Change: G4S

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000105356
Gene: ENSMUSG00000005161
AA Change: G4S

DomainStartEndE-ValueType
Pfam:Redoxin 7 159 1.3e-21 PFAM
Pfam:AhpC-TSA 8 141 1.3e-44 PFAM
Pfam:1-cysPrx_C 161 196 8.6e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109736
SMART Domains Protein: ENSMUSP00000105358
Gene: ENSMUSG00000052926

DomainStartEndE-ValueType
Pfam:RNase_HII 31 242 1.3e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109738
SMART Domains Protein: ENSMUSP00000105360
Gene: ENSMUSG00000052926

DomainStartEndE-ValueType
Pfam:RNase_HII 31 242 5.5e-53 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122931
Predicted Effect probably benign
Transcript: ENSMUST00000125893
AA Change: G4S

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000122694
Gene: ENSMUSG00000005161
AA Change: G4S

DomainStartEndE-ValueType
Pfam:Redoxin 7 147 1.4e-21 PFAM
Pfam:AhpC-TSA 8 141 2.3e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127215
Predicted Effect probably benign
Transcript: ENSMUST00000128972
SMART Domains Protein: ENSMUSP00000121864
Gene: ENSMUSG00000052926

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:RNase_HII 57 268 1.4e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130902
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137791
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138748
Predicted Effect probably benign
Transcript: ENSMUST00000140561
SMART Domains Protein: ENSMUSP00000118442
Gene: ENSMUSG00000052926

DomainStartEndE-ValueType
Pfam:RNase_HII 31 54 4e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143402
Predicted Effect probably benign
Transcript: ENSMUST00000147812
SMART Domains Protein: ENSMUSP00000120374
Gene: ENSMUSG00000052926

DomainStartEndE-ValueType
Pfam:RNase_HII 31 242 1.3e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164807
AA Change: G4S

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000126451
Gene: ENSMUSG00000005161
AA Change: G4S

DomainStartEndE-ValueType
Pfam:Redoxin 7 159 1.3e-21 PFAM
Pfam:AhpC-TSA 8 141 1.3e-44 PFAM
Pfam:1-cysPrx_C 161 196 8.6e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209372
Predicted Effect probably benign
Transcript: ENSMUST00000214133
Meta Mutation Damage Score 0.0598 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peroxiredoxin family of antioxidant enzymes, which reduce hydrogen peroxide and alkyl hydroperoxides. The encoded protein plays an antioxidant protective role in cells, and it may contribute to the antiviral activity of CD8(+) T-cells. The crystal structure of this protein has been resolved to 2.7 angstroms. This protein prevents hemolytic anemia from oxidative stress by stabilizing hemoglobin, thus making this gene a therapeutic target for patients with hemolytic anemia. This protein may have a proliferative effect and play a role in cancer development or progression. Related pseudogenes have been identified on chromosomes 5, 6, 10 and 13. [provided by RefSeq, Mar 2013]
PHENOTYPE: Homozygous null mice have hemolytic anemia and exhibit enlarged spleens due to congestion of the red pulp. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A T 7: 120,318,762 K1496* probably null Het
Anapc1 C A 2: 128,634,693 R1335L probably damaging Het
Arhgef10l A T 4: 140,578,294 S203T probably benign Het
Astn1 C T 1: 158,664,104 T41I possibly damaging Het
Avil A G 10: 127,013,644 N603S probably benign Het
Brca1 T C 11: 101,531,090 D149G possibly damaging Het
Col19a1 A C 1: 24,559,768 probably null Het
Cps1 T C 1: 67,229,418 V1435A possibly damaging Het
Cyp2j6 A T 4: 96,518,157 I459N probably damaging Het
Cyth1 T C 11: 118,182,306 E242G probably damaging Het
Dclk3 T G 9: 111,467,670 L94R possibly damaging Het
Dsg3 T C 18: 20,540,134 V954A probably damaging Het
Dync2h1 T A 9: 7,111,487 D309V probably damaging Het
Efhd2 A G 4: 141,874,567 F101L probably benign Het
Fgd5 T A 6: 91,988,235 M325K possibly damaging Het
Fras1 T C 5: 96,710,077 S2077P probably benign Het
Frmpd1 A T 4: 45,279,340 E688D probably benign Het
Hspg2 T C 4: 137,562,201 V3824A probably benign Het
Kctd16 A G 18: 40,259,151 E264G probably benign Het
Mapk15 A T 15: 75,996,077 K153* probably null Het
Miox G A 15: 89,335,581 V91I probably benign Het
Nfyb G A 10: 82,755,002 A65V possibly damaging Het
Olfr1241 A G 2: 89,482,803 F111L probably benign Het
Olfr1442 C A 19: 12,674,860 F218L probably benign Het
Olfr646 T C 7: 104,106,605 S109P probably damaging Het
Parp9 T C 16: 35,948,341 I64T probably damaging Het
Pfkfb4 T C 9: 108,998,889 V43A probably benign Het
Pgap1 A T 1: 54,494,825 V643E probably damaging Het
Pip5k1b T A 19: 24,379,047 M176L probably benign Het
Ppfia4 A T 1: 134,324,217 probably null Het
Rin3 A G 12: 102,313,081 I50V possibly damaging Het
Rtl1 G A 12: 109,595,407 probably benign Het
Sgsm3 G C 15: 81,009,466 D434H probably damaging Het
Shank2 T C 7: 144,410,577 S634P possibly damaging Het
Sik2 A G 9: 50,899,475 M447T possibly damaging Het
Sla2 A G 2: 156,883,587 probably null Het
Spata16 T A 3: 26,913,267 F389I probably damaging Het
Srebf1 G A 11: 60,201,804 A793V probably benign Het
Tmed11 T A 5: 108,777,412 D178V probably damaging Het
Traf7 A G 17: 24,513,926 F110L probably benign Het
Ttn T A 2: 76,725,564 I30366F probably damaging Het
Ubqlnl C T 7: 104,150,192 V33M probably damaging Het
Vmn1r194 A G 13: 22,245,047 Y278C probably damaging Het
Vmn2r100 C A 17: 19,522,120 P252Q possibly damaging Het
Vmn2r114 A T 17: 23,310,575 Y184* probably null Het
Vmn2r53 C T 7: 12,582,066 A609T probably damaging Het
Vps13b A G 15: 35,572,119 T961A probably benign Het
Xirp2 T A 2: 67,519,278 N3272K probably damaging Het
Zfp217 C T 2: 170,115,462 A539T probably benign Het
Zfp454 T A 11: 50,883,775 T24S possibly damaging Het
Other mutations in Prdx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02296:Prdx2 APN 8 84974052 missense probably benign
IGL03126:Prdx2 APN 8 84971569 missense probably damaging 1.00
R0091:Prdx2 UTSW 8 84971701 unclassified probably benign
R0109:Prdx2 UTSW 8 84970251 missense probably benign 0.08
R5288:Prdx2 UTSW 8 84971673 nonsense probably null
R7788:Prdx2 UTSW 8 84971674 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- ACTCCATAATTTGGGTAGCAGCGG -3'
(R):5'- TGAACTGAGAGTCCACAGACACTCC -3'

Sequencing Primer
(F):5'- AGCGGTGACCCATCATTC -3'
(R):5'- GTCGCTAAAAGCGATGATCTC -3'
Posted On2013-08-06