Incidental Mutation 'R8061:Dclk2'
ID 642061
Institutional Source Beutler Lab
Gene Symbol Dclk2
Ensembl Gene ENSMUSG00000028078
Gene Name doublecortin-like kinase 2
Synonyms Dcamkl2, Click-II, 6330415M09Rik
MMRRC Submission
Accession Numbers

Genbank: NM_027539; MGI: 1918012

Essential gene? Non essential (E-score: 0.000) question?
Stock # R8061 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 86786151-86920852 bp(-) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) T to C at 86813674 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000142267 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029719] [ENSMUST00000191752] [ENSMUST00000192773] [ENSMUST00000193632] [ENSMUST00000194452] [ENSMUST00000195561]
AlphaFold Q6PGN3
Predicted Effect probably benign
Transcript: ENSMUST00000029719
SMART Domains Protein: ENSMUSP00000029719
Gene: ENSMUSG00000028078

DomainStartEndE-ValueType
low complexity region 18 43 N/A INTRINSIC
DCX 67 158 2.29e-42 SMART
DCX 191 279 2.17e-34 SMART
low complexity region 291 317 N/A INTRINSIC
low complexity region 323 346 N/A INTRINSIC
S_TKc 393 650 4.96e-101 SMART
low complexity region 718 740 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000191752
SMART Domains Protein: ENSMUSP00000141707
Gene: ENSMUSG00000028078

DomainStartEndE-ValueType
low complexity region 18 43 N/A INTRINSIC
DCX 67 158 2.29e-42 SMART
DCX 191 279 2.17e-34 SMART
low complexity region 291 317 N/A INTRINSIC
low complexity region 323 346 N/A INTRINSIC
S_TKc 393 646 2.4e-76 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000192773
SMART Domains Protein: ENSMUSP00000141567
Gene: ENSMUSG00000028078

DomainStartEndE-ValueType
low complexity region 18 43 N/A INTRINSIC
DCX 67 158 1.1e-44 SMART
DCX 191 279 9.9e-37 SMART
low complexity region 291 317 N/A INTRINSIC
low complexity region 323 346 N/A INTRINSIC
S_TKc 392 641 8.6e-81 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000193632
SMART Domains Protein: ENSMUSP00000141866
Gene: ENSMUSG00000028078

DomainStartEndE-ValueType
low complexity region 18 43 N/A INTRINSIC
DCX 67 158 1.1e-44 SMART
DCX 191 279 9.9e-37 SMART
low complexity region 291 317 N/A INTRINSIC
low complexity region 339 362 N/A INTRINSIC
S_TKc 409 666 2.4e-103 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000194452
SMART Domains Protein: ENSMUSP00000141816
Gene: ENSMUSG00000028078

DomainStartEndE-ValueType
low complexity region 18 43 N/A INTRINSIC
DCX 67 158 2.29e-42 SMART
DCX 191 279 2.17e-34 SMART
low complexity region 291 317 N/A INTRINSIC
low complexity region 323 346 N/A INTRINSIC
Pfam:Pkinase_Tyr 392 590 2.2e-31 PFAM
Pfam:Pkinase 392 591 4.7e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195561
SMART Domains Protein: ENSMUSP00000142267
Gene: ENSMUSG00000028078

DomainStartEndE-ValueType
low complexity region 18 43 N/A INTRINSIC
DCX 67 158 2.29e-42 SMART
DCX 191 279 2.17e-34 SMART
low complexity region 291 317 N/A INTRINSIC
low complexity region 323 346 N/A INTRINSIC
S_TKc 392 649 4.96e-101 SMART
low complexity region 717 739 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: This gene encodes a member of the protein kinase superfamily and the doublecortin family. The protein encoded by this gene contains two N-terminal doublecortin domains, which bind microtubules and regulate microtubule polymerization, a C-terminal serine/threonine protein kinase domain, which shows substantial homology to Ca2+/calmoduline-dependent protein kinase, and a serine/proline-rich domain in between the doublecortin and the protein kinase domains, which mediates multiple protein-protein interactions. The microtubule-polymerizing activity of the encoded protein is independent of its protein kinase activity. This gene and the DCX gene, another family member, share function in the establishment of hippocampal organization and their absence results in a severe epileptic phenotype and lethality, as described in human patients with lissencephaly. Multiple alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Sep 2010]
Allele List at MGI

All alleles(59) : Targeted, knock-out(1) Gene trapped(58)

Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230110C19Rik A G 9: 8,042,671 W37R probably damaging Het
Acads G A 5: 115,117,651 R42C probably benign Het
Agrn G A 4: 156,178,954 R338C probably damaging Het
Anapc1 T C 2: 128,648,488 E1008G probably damaging Het
Art5 A T 7: 102,098,249 Y108N possibly damaging Het
As3mt G A 19: 46,740,543 C369Y probably damaging Het
Asb3 A G 11: 30,998,447 N41S probably damaging Het
Astn1 G A 1: 158,504,350 probably null Het
Asxl3 T A 18: 22,524,243 M1770K possibly damaging Het
Atp8b2 T C 3: 89,946,220 probably benign Het
Chrm1 T C 19: 8,679,154 Y408H possibly damaging Het
Chst2 T C 9: 95,405,171 H374R probably damaging Het
Cnot1 A G 8: 95,765,027 F390L possibly damaging Het
Comt T C 16: 18,411,290 Y100C probably benign Het
Dicer1 G A 12: 104,702,818 Q1202* probably null Het
Disp1 C T 1: 183,087,587 V1090M probably damaging Het
Dnajc28 T C 16: 91,617,170 D62G possibly damaging Het
Dock1 C T 7: 134,772,323 T566I probably benign Het
Dopey1 T G 9: 86,521,193 M18R possibly damaging Het
Dopey2 T C 16: 93,749,996 L296P probably damaging Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Efcab3 A T 11: 105,106,449 D155V probably benign Het
Ehmt2 T C 17: 34,905,927 S465P possibly damaging Het
Eno1b G A 18: 48,047,658 W301* probably null Het
Fam49a G T 12: 12,362,027 A150S possibly damaging Het
Fpgt A G 3: 155,087,266 S375P probably benign Het
Gas2l1 G A 11: 5,061,785 S348F possibly damaging Het
Gen1 A T 12: 11,261,076 probably benign Het
Gm16486 A G 8: 70,708,575 E139G probably benign Het
Ice1 A T 13: 70,603,732 C1412S probably damaging Het
Klhl2 A C 8: 64,758,223 L264V probably damaging Het
Lars2 A G 9: 123,459,497 T803A probably benign Het
Ldb2 T A 5: 44,480,270 K232M probably damaging Het
Lix1 G A 17: 17,443,676 R92Q probably damaging Het
Meig1 C T 2: 3,409,203 V87I not run Het
Mitf A C 6: 97,993,298 S176R probably damaging Het
Myh7 A G 14: 54,990,941 V236A probably benign Het
Myo5a T A 9: 75,122,957 Y119* probably null Het
Ncapg2 A G 12: 116,426,577 N382S probably benign Het
Neu2 C T 1: 87,596,911 P206L probably damaging Het
Olfr753-ps1 A G 17: 37,169,901 F147S probably damaging Het
Osbpl5 C T 7: 143,702,724 R454Q probably benign Het
Panx1 A G 9: 15,045,001 S13P possibly damaging Het
Pde2a A G 7: 101,503,972 D413G probably benign Het
Plcb1 A T 2: 135,346,396 Y803F probably benign Het
Prrc2a T C 17: 35,161,186 probably benign Het
Pth2r T A 1: 65,343,501 Y143N possibly damaging Het
Ptpn4 C T 1: 119,691,600 probably null Het
Rapgef3 T C 15: 97,761,520 Y112C probably benign Het
Rusc2 A G 4: 43,422,492 N907S probably damaging Het
Scn7a T A 2: 66,692,594 N922I probably damaging Het
Shprh T C 10: 11,212,333 V1620A possibly damaging Het
Slc25a54 T A 3: 109,111,045 S280R probably damaging Het
Slc30a5 T C 13: 100,828,911 I63M probably damaging Het
Smg1 A T 7: 118,152,387 V2817E unknown Het
Sprr3 T C 3: 92,456,877 E220G probably damaging Het
Tcf21 T C 10: 22,819,863 E14G probably benign Het
Tenm4 A G 7: 96,852,456 D1289G probably damaging Het
Tmem121b C A 6: 120,492,103 G551V probably damaging Het
Tpk1 A G 6: 43,346,844 S224P probably damaging Het
Trib1 T C 15: 59,651,555 I146T probably damaging Het
Ttc32 T A 12: 9,034,953 Y58N probably damaging Het
Vcan T A 13: 89,657,290 I3336L probably benign Het
Vmn1r200 C A 13: 22,395,283 Y85* probably null Het
Vps39 T C 2: 120,344,211 I97V probably benign Het
Zan T A 5: 137,436,631 I2167F unknown Het
Zfp37 A T 4: 62,191,428 Y507* probably null Het
Zfp39 A G 11: 58,902,747 V55A probably benign Het
Zfp616 A T 11: 74,083,514 N294I possibly damaging Het
Zfp729a T C 13: 67,620,089 T674A probably benign Het
Other mutations in Dclk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Dclk2 APN 3 86799090 critical splice acceptor site probably null
IGL01769:Dclk2 APN 3 86816360 missense possibly damaging 0.50
IGL01802:Dclk2 APN 3 86799027 missense probably damaging 1.00
IGL02296:Dclk2 APN 3 86793293 missense probably damaging 1.00
IGL02390:Dclk2 APN 3 86824683 missense probably damaging 0.99
IGL02522:Dclk2 APN 3 86920116 missense probably benign 0.01
IGL03104:Dclk2 APN 3 86836359 missense probably damaging 1.00
IGL03337:Dclk2 APN 3 86906059 missense probably damaging 1.00
R0219:Dclk2 UTSW 3 86813669 splice site probably benign
R0400:Dclk2 UTSW 3 86813747 splice site probably null
R0606:Dclk2 UTSW 3 86906004 missense probably damaging 1.00
R1537:Dclk2 UTSW 3 86806184 missense probably damaging 0.97
R1569:Dclk2 UTSW 3 86805639 missense possibly damaging 0.50
R1571:Dclk2 UTSW 3 86805639 missense possibly damaging 0.50
R1612:Dclk2 UTSW 3 86805639 missense possibly damaging 0.50
R1680:Dclk2 UTSW 3 86805639 missense possibly damaging 0.50
R1689:Dclk2 UTSW 3 86805639 missense possibly damaging 0.50
R1714:Dclk2 UTSW 3 86906093 missense probably benign 0.00
R1745:Dclk2 UTSW 3 86805639 missense possibly damaging 0.50
R1746:Dclk2 UTSW 3 86805639 missense possibly damaging 0.50
R1752:Dclk2 UTSW 3 86806127 missense possibly damaging 0.61
R1829:Dclk2 UTSW 3 86805639 missense possibly damaging 0.50
R2008:Dclk2 UTSW 3 86920035 missense probably damaging 1.00
R2125:Dclk2 UTSW 3 86805639 missense possibly damaging 0.50
R2126:Dclk2 UTSW 3 86805639 missense possibly damaging 0.50
R2132:Dclk2 UTSW 3 86920046 missense probably benign 0.44
R2314:Dclk2 UTSW 3 86920035 missense probably damaging 1.00
R2338:Dclk2 UTSW 3 86799017 missense probably damaging 1.00
R2849:Dclk2 UTSW 3 86793223 missense probably damaging 1.00
R3108:Dclk2 UTSW 3 86920035 missense probably damaging 1.00
R3109:Dclk2 UTSW 3 86920035 missense probably damaging 1.00
R3615:Dclk2 UTSW 3 86920035 missense probably damaging 1.00
R3616:Dclk2 UTSW 3 86920035 missense probably damaging 1.00
R4051:Dclk2 UTSW 3 86830822 critical splice donor site probably null
R4052:Dclk2 UTSW 3 86830822 critical splice donor site probably null
R4208:Dclk2 UTSW 3 86830822 critical splice donor site probably null
R4643:Dclk2 UTSW 3 86806180 missense possibly damaging 0.93
R4654:Dclk2 UTSW 3 86836376 missense probably damaging 1.00
R4693:Dclk2 UTSW 3 86815093 missense possibly damaging 0.67
R4716:Dclk2 UTSW 3 86919881 missense probably damaging 1.00
R4914:Dclk2 UTSW 3 86824742 splice site probably null
R4915:Dclk2 UTSW 3 86824742 splice site probably null
R4917:Dclk2 UTSW 3 86824742 splice site probably null
R5218:Dclk2 UTSW 3 86805678 missense probably damaging 1.00
R5510:Dclk2 UTSW 3 86906037 missense possibly damaging 0.93
R5520:Dclk2 UTSW 3 86919840 missense probably damaging 1.00
R5867:Dclk2 UTSW 3 86791859 makesense probably null
R5976:Dclk2 UTSW 3 86787225 missense possibly damaging 0.53
R6048:Dclk2 UTSW 3 86905965 missense probably damaging 1.00
R6111:Dclk2 UTSW 3 86805661 missense probably benign 0.28
R6192:Dclk2 UTSW 3 86815150 missense probably damaging 1.00
R6289:Dclk2 UTSW 3 86831817 missense probably benign 0.18
R6595:Dclk2 UTSW 3 86792067 critical splice donor site probably benign
R6897:Dclk2 UTSW 3 86831763 missense probably benign 0.00
R7061:Dclk2 UTSW 3 86831731 critical splice donor site probably null
R7095:Dclk2 UTSW 3 86793259 missense probably damaging 1.00
R7096:Dclk2 UTSW 3 86793259 missense probably damaging 1.00
R7208:Dclk2 UTSW 3 86799602 splice site probably null
R7253:Dclk2 UTSW 3 86793259 missense probably damaging 1.00
R7256:Dclk2 UTSW 3 86793259 missense probably damaging 1.00
R8003:Dclk2 UTSW 3 86793301 critical splice acceptor site probably null
R8927:Dclk2 UTSW 3 86831741 missense probably damaging 1.00
R8928:Dclk2 UTSW 3 86831741 missense probably damaging 1.00
R8964:Dclk2 UTSW 3 86836391 missense probably damaging 1.00
R9704:Dclk2 UTSW 3 86920080 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- ATCTCCCAGAGAAGAGAGTTTTAC -3'
(R):5'- CCTTTCCACACTGTGTAAGGG -3'

Sequencing Primer
(F):5'- CCCAGAGAAGAGAGTTTTACATTTTC -3'
(R):5'- TAAGGGGCAGAGGTGTCTC -3'
Posted On 2020-07-30